Preparation and optical characterization of metallic nanoparticles

... A novel high-activity D-hydantoinase from Jannaschia sp CCS1 obtain optically pure amino acids, namely chemical and enzymatic syntheses Chemical synthesis gives racemic mixtures of amino acids ... precipitate fraction; sup, supernatant fraction The molecular weight standard (lane M) is indicated on the right A novel high-activity D-hydantoinase from Jannaschia sp...

Ngày tải lên: 18/02/2014, 08:20

... Kumagaye KY, Nakajima K, Watanabe T, Kawai T, Kawakami Y, Niidome T, Sawada K, Nishizawa Y et al (1994) Omega-agatoxinTK containing D-serine at position 46, but not synthetic omega-[L-Ser46]agatoxin-TK, ... Inoue A, Kawakami Y, Nishizawa Y, Katayama K & Kuwada M (1995) Isolation and characterization of a peptide isomerase from funnel web spider venom J Biol Chem 270, 16719–16723 To...

Ngày tải lên: 18/02/2014, 17:20

... mechanism of both RNA and DNA synthesis [17] In a previous study, we reported the findings of an analysis of the complete sequence of the cryptic plasmid pIT3 isolated from the crenarchaeon S solfataricus ... analyses of the predicted amino acid sequence showed that the C-terminal half of the RepA of the pIT3 plasmid is sequence-similar to the heli...

Ngày tải lên: 18/02/2014, 18:20

... TTCTCGAGATGGGAAAGTCTTCAGAGT GGT ACMSD real-time PCR: primer and probe ⁄ 3fw TGGCCAGATCTAAAAAAGAGGT 2fw ATCCCAGGAAACACCAGTAGA 10rev ATTGTTTTCTCTCAAGACCCAA TaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG ... kit (Stratagene, La Jolla, CA, USA) Mutagenic primers were: 5¢-CGCTCGAGA TGAAAATTGACATCGCTAGTCATATTCTACC-3¢ and its complement for His6Ala; 5¢-GACATCCATAGTGCT ATTCTACCAAAAGAATGGCC-3¢ and it...

Ngày tải lên: 19/02/2014, 02:20

... 5¢-CTTTATTTTCAGGGCGCCATGAAGCGCG CAAGACCGTCTGAA-3¢ and a reverse oligomer 5¢-AGCT CGAATTCG GATCCGGTACCTCAGAAGGTAGACAG CAGAACC-3¢ For derivitization with TMR, a Gly-Gly-Cys sequence was introduced at the ... chain and hides a large amount of the hydrophobic surface area Surface area calculations for the pentamer give a total surface ˚ ˚ area of $ 81 000 A2 with 30% ($ 24 000 A...

Ngày tải lên: 19/02/2014, 06:20

... above and in [1]) We investigated representative gene products from the E coli and Synechocystis sp bacteria further, to gain insight into the function of these proteins and the evolution of the MAPEG ... the six MAPEG families and three further groups (Insect, E.coliMGST cluster and SynMGST cluster) A major subgrouping is visible with MGST1, PGES and Insect in...

Ngày tải lên: 19/02/2014, 17:20

... stearothermophilus adenylate kinase with bound Ap5A, Mg2+ Ap5A, and Mn2+ Ap5A reveal an intermediate lid position and six coordinate octahedral geometry for bound Mg2+ and Mn2+ Proteins 32, 27 6 28 8 29 Kanaani, ... M (1996) Ancient divergence of long and short isoforms of adenylate kinase: molecular evolution of the nucleoside monophosphate kinase family FEBS Lett...

Ngày tải lên: 21/02/2014, 00:20

... the hydrothermal conditions are: x # 0:2 for Sn4þ in the a-Fe2O3 and x $ 0:7 for Fe3þ in SnO2 This paper is the first report on the hydrothermal synthesis and structural characterization of (1 ... with coordinates of ð0; 0; zÞ occupy 2/3 of the octahedral holes in successive oxygen layers, and 1/3 of the octahedral holes with coordinates of ð0; 0; 0Þ are empty In the...

Ngày tải lên: 19/03/2014, 16:48

... Journal of Science, Mathematics - Physics 25 (2009) 221-230 In this paper, we report on synthesis and characterization of gold NPs as well as CoPt and FePt NPs Experimental Synthesis of gold ... under a mixture of % H2 and 95 % Ar atmosphere The increasing rate of temperature was 6°C/min and cooling with the furnace The sonoelectrodeposition method has been used for syn...

Ngày tải lên: 28/03/2014, 13:20

... images of the ZnO nanorods; (c) low- and (d) high-magnification FESEM images of the ZnO submicrorods and (e) low- and (f) high-magnification FESEM images of the ZnO microrods detailed morphology of ... diameters of about 200 nm and lenghts of lm Fig 2e and f shows the SEM images of the ZnO microrods The lower magnification image (2e) indicates that ZnO microrods...

Ngày tải lên: 06/05/2014, 13:22

... investigate the effect of Zn2+ partially substituting for Co2+ in CoFe2O4 nanoparticles (Co1-xZnxFe2O4; x = 0, 0.5, and 1) and shelling with silica on the magnetic and optical properties of the ferrite ... the magnetic properties and diffuse reflectance of the prepared ferrite nanoparticles, respectively Results and discussion Figure 1a, b, c shows the X-ray diffract...

Ngày tải lên: 21/06/2014, 01:20

... region The direct energy gap Eg of the SnS nanowires has been calculated as 1.59 eV, and this experimental optical band gap value is the evidence for the quantum confinement of the SnS nanowires ... images of AAO template and SnS nanowire arrays a The sample was etched for 10 h b The SnS nanowires with a diameter of about 50 nm c The SAED pattern taken f...

Ngày tải lên: 22/06/2014, 01:20

... DEVELOPMENT OF MICROEXTRACTION- BASED TECHNIQUES FOR QUANTIFICATION AND BEHAVIOR CHARACTERIZATION OF NANOPARTICLES IN AQUATIC ENVIRONMENTS SEYED MOHAMMAD MAJEDI (M.Sc., AMIRKABIR UNIVERSITY OF ... applications of CuO on the basis of the number of papers published in the Institute for Scientific Information (ISI) Web of Science, as reported in Table 1...

Ngày tải lên: 09/09/2015, 08:18

... nm, and (e) 7.1 nm 3.2 Synthesis and Characterization of Pt /SBA-15 Catalysts 3.2.1 Incorporation of the Pt Particles in SBA-15 Structure SBA-15 with a pore diameter of 9.0 nm was used as a catalyst ... the conditions of catalyst synthesis The minimal change in SBA-15 physical parameters after incorporation of Pt into the silica reveals that there is no signific...

Ngày tải lên: 08/10/2015, 23:16

... Method 2: Preparation of AuAg Alloy and Pure Metal Nanoparticles Using a Modified Procedure 32 3.2.4.1 Preparation of AuAg Alloy Nanoparticles 32 3.2.4.2 Preparation of Ag Nanoparticles ... Chapter Conclusion 89 5.1 Preparation of AuAg alloy nanoparticles 89 5.2 Optical Characterization of the Metallic Nanoparticles 90 5.2.1 Optical Limiting Measurement...

Ngày tải lên: 16/10/2015, 11:58