Understanding the functional roles of intrinsic protein disorder in NFkB transcription factors

... ratios: at a : Fe2+ ⁄ protein ratio, the resonances of Arg20, Asp22 and Asp23 disappeared, and the resonance of Leu21 shifted At a : ratio, the resonances of residues 19 and 44 also disappeared, ... spectrum of CyaY, but the most striking consequence of the addition was the total disappearance of specific resonances without the concomitant appearance of other...

Ngày tải lên: 18/02/2014, 16:20

... 6A,B) In the present study, we compared the functional roles of the N- and C-terminal regions of 4482 H Tanaka et al molluskan and vertebrate TnI and revealed for the first time that (a) the alternative ... of the troponin complex In molluskan muscles, the C-terminal region does not function and troponin regulates contraction only through the act...

Ngày tải lên: 20/02/2014, 01:20

... On the basis of the results with antibodies, a series of PrP mutants were made to assess whether deletions of certain domains of the protein decrease the SOD-like activity of the protein The domains ... the SOD activity We determined that the active site consists of two domains The first includes the Cu-binding domain and the second includes the conser...

Ngày tải lên: 21/02/2014, 00:20

... 5¢-CAGAATTCatg gagcagaagctgatctccgaggaggacctgctgGTGAACAACTCCAC CAACTCCTCCAACAACTCCCTGGCTCTTACAAGTC CTTATAAGACA-3¢; HsM2-as, 5¢-TTACCTTGTAGCG CCTATGTTCTTATAATG-3¢ (An engineered EcoRI recognition ... the coupling of M2 with GOA-1 We prepared an M2 mutant: :GOA-1 fusion protein and directly assessed the muscarinic- ligand-dependent activation of GOA-1 Results Expressio...

Ngày tải lên: 07/03/2014, 11:20

... 5¢-CGTCGTCGAAATTCTCCTTGTACGTGTCC-3¢ 5¢-CACGTACAAAGAGAACGTCGACGACG-3¢ 5¢-CGTCGTCGACGTTCTCTTTGTACGTG-3¢ 5¢-GAGAATTTCGAGCACGATACAGACTCCC-3¢ 5¢-GGGAGTCTGTATCGTGCTCGAAATTCTC-3¢ 5¢-CGACGACGAGACAGACTCCCAGAACATGTC-3¢ 5¢-GACATGTTCTGGGAGTCTGTCTCGTCGTCG-3¢ ... investigated by site-directed mutagenesis of a- crystallin domain residues and molecular modeling of protein structure The p26 a...

Ngày tải lên: 07/03/2014, 12:20

... number of protein protein interactions ⁄ number of complexes (inter ⁄ comp.), while the STRING search results are presented as number of protein protein interactions (inter.) only Proteins are ... contained regions of intrinsic disorder One example of an ordered hub, calmodulin, makes use of a flexible hinge to facilitate binding diversity Each of these classes and thei...

Ngày tải lên: 07/03/2014, 21:20

... for N2C2 and N2Cc In conclusion, the accessibility of the active site was better in the protein bearing the N2 domain than in the protein bearing the Nc domain Thus, the accessibility of the active ... both the N-terminal and C-terminal domains of hoPLRP2 contributed to the stability of the protein in the presence of the water–lipid interfac...

Ngày tải lên: 16/03/2014, 06:20

... Lgt4 Results In order to investigate the function of the glycosyltransferase enzymes involved in the biosynthesis of LOS of M catarrhalis, and to gain some insights into the mechanism of serotype ... irradiating each of the anomeric signals in turn to obtain the H chemicals shifts of the corresponding remaining ring protons Again, assignment of the Kdo...

Ngày tải lên: 30/03/2014, 08:20

... al.: The contrasting roles of PPARδ and PPARg in regulating the metabolic switch between oxidation and storage of fats in white adipose tissue Genome Biology 2011 12:R75 Submit your next manuscript ... contrast the roles of PPARg and PPARδ in regulating metabolism in white adipose tissue, we have Page of 19 performed a metabolo...

Ngày tải lên: 09/08/2014, 23:20

... WRKY40 and WRKY60 proteins indeed function in a complex pattern in plant responses to ABA and abiotic stresses The complex roles of the three WRKY transcription factors in plant biotic and abiotic ... al.: Roles of arabidopsis WRKY18, WRKY40 and WRKY60 transcription factors in plant responses to abscisic acid and abiotic st...

Ngày tải lên: 11/08/2014, 11:21

... present in the tissues lacking TIP1;1 (Fig 2) It is therefore possible that these remaining isoforms compensate for the lack of TIP1;1 in the knockout On the other hand, the effect of the absence of ... expression of TIP3;1 and TIP1;1 in Arabidopsis and found minimal overlap in the timing of their expression, with TIP3;1 being abundant in embryos of matur...

Ngày tải lên: 12/08/2014, 03:21

... determine the closeness of the semantic information of proteins as metrics for evaluating the functional coherence of any group proteins Directly utilizing the semantic information from the biomedical ... evaluate the ability of the GO derived metrics to differentiate the functionally coherent protein groups from the noncoherent ones For the c...

Ngày tải lên: 14/08/2014, 08:20

... THE FUNCTIONAL INVESTIGATION OF FORKHEAD FACTOR FOXQ1 IN HUMAN BREAST AND COLON CANCERS QIAO YUANYUAN MRes, Newcastle University, UK A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY ... that FOXQ1 has potential therapeutic significance against breast cancer progression and invasion In this study, the functional role of FOXQ1 was investi...

Ngày tải lên: 10/09/2015, 15:51

... verified intrinsically disordered regions[46] 1.3.3 Functional Conservation of Intrinsic Protein Disorder The functional importance of intrinsically disordered proteins and protein regions raises the ... Role of Intrinsic Protein Disorder in Cell Signaling In the context of cell signaling, intrinsically disordered proteins and regions have been associated w...

Ngày tải lên: 12/10/2015, 17:35

... OH COOCH2 Fig Structure of cofactor F4 20 from mycobacterium N N O NH O Figure 1.4 Structure of cofactor F4 20 in Mycobacterium sp Masters Thesis 23   The structures of coenzyme F4 20 in MTB, M ... strain incapable of expressing fbiC and biosynthesising cofactor F4 20 mutant M bovis BCG capable of expressing fbiC via complementation with a copy of the fbiC ge...

Ngày tải lên: 16/10/2015, 15:38