... comparable study of visually-induced motion sickness We were especially interested in replicating and extending research by Drummond and Granston that showed that visually-induced motion sickness in ... herein extends this line of research by combining a visual motion sickness- inducing stimulus with pain and pre-treatment with rizatriptan In this study, r...
Ngày tải lên: 26/10/2012, 09:57
... serine and glycine was reduced from 33% in the light to 25% in the dark (Fig 7A) Glutamine and asparagine were the major amino acids in the xylem sap in both the light (63% of the total amino acids) ... 3195 Amino acid metabolism and translocation M.-H Valadier et al Table Amino acid composition in leaves, and amino acid percentage ratio i...
Ngày tải lên: 18/02/2014, 18:20
Tài liệu Báo cáo Y học: Short peptides are not reliable models of thermodynamic and kinetic properties of the N-terminal metal binding site in serum albumin doc
... histidines (His67 and His247, presumably providing metal binding at site II and the neighbouring His242) bind phosphate ions, thereby providing another level of competition for metal ion binding Kinetics ... modelling of Cu(II) and Ni(II) transport by albumins On the other hand, the direct thermodynamic and kinetic characterization of Ni(II) binding at sit...
Ngày tải lên: 22/02/2014, 04:20
Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx
... 5¢-TTCACGATTGAACAGGTAAACAAAATTTTCC CTTTTTAGAACGACATGCAGCTGAAGCTTCGTA CGC-3¢ and disRAS1rev CAAAACCATGTCATAT CAAGAGAGCAGGATCATTTTCAACAAATTATGC ATAGGCCACTAGGGATCTG-3¢ YEp351 -SUT2 was constructed to contain SUT2 as the ... yeast/ info/tools/hegemann/gfp.html) using the primers SUT-GFPfwd 5¢-GACTGTCGATGATTATGGTTGCC CGCTGGCTTCCAAACCCTTATCGATACCGTCGA CCC-3¢ and SUT-GFPrev 5¢-AACAATTTCACACA...
Ngày tải lên: 07/03/2014, 15:20
Báo cáo khoa học: Dissecting the role of the N-terminal metal-binding domains in activating the yeast copper ATPase in vivo pptx
... [36,37] The current hypothesis involves domain–domain interactions between the N-terminus and other domains of the ATPase Indeed, in vitro studies of the purified N-terminus and catalytic loop of the ... Wilson ATPase have shown that these two domains interact in the absence of copper and that their interaction is diminished by copper binding to the N-term...
Ngày tải lên: 23/03/2014, 05:22
Báo cáo khoa học: The inhibition of Ras farnesylation leads to an increase in p27Kip1 and G1 cell cycle arrest pdf
... HR12 induces arrest of Rat1 /ras cells at the G1 phase of the cell cycle We next examined the effect of HR12 on the distribution of Rat1 /ras cells in the cell cycle To resolve the G1, S and G2/M phases, ... addition, and immunoblotted with anti -p27Kip1 Ig and with anti-actin Ig as a control The diagram shows quantification of the intensity...
Ngày tải lên: 31/03/2014, 01:20
Báo cáo khoa học: Inhibition of human MDA-MB-231 breast cancer cell invasion by matrix metalloproteinase 3 involves degradation of plasminogen docx
... stroma 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 of breast carcinomas correlates with tumour recurrence Int J Cancer Res 58, 1–6 Lijnen, H.R (2002) Matrix metalloproteinases and cellular ... abrogate the invasion stimulating effects of plasminogen upon MDA-MB- 231 cells, confirming dependence upon plasmin activity [14] MMP -3 inhibition of MDA-MB- 231...
Ngày tải lên: 31/03/2014, 09:20
báo cáo hóa học: " Effects of betaine on lipopolysaccharide-induced memory impairment in mice and the involvement of GABA transporter 2" doc
... levels of glial markers and the betaine transporter Glial activation is also involved in the pathogenesis of LPS-induced memory impairment; therefore, to understand the effects of betaine on these ... - 13 - Effects of acute administration of betaine on LPS-induced memory impairment We further examined whether a single administration of betaine i...
Ngày tải lên: 19/06/2014, 22:20
Báo cáo hóa học: " Inhibition of foot-and-mouth disease virus replication in vitro and in vivo by small interfering RNA" pot
... Rogel Arie, et al.: Inhibition of foot -and- mouth disease virus replication by small interfering RNA Journal of General Virology 2004, 85:3213-3217 Publish with Bio Med Central and every scientist ... Sharp PA: siRNA-directed inhibition of HIV-1 infection Nat Med 2002, 8:681-686 Shlomai A, Shaul Y: Inhibition of hepatitis B virus expression and replication...
Ngày tải lên: 20/06/2014, 01:20
báo cáo hóa học:" Role of the VEGF-Flt-1-FAK pathway in the pathogenesis of osteoclastic bone destruction of giant cell tumors of bone" pptx
... VEGF activates the VEGF-Flt-1-FAK pathway The activation of this signaling pathway might be involved in the migration of these cells into the lesion at the site of bone destruction in GCTs We recently ... order to determine the possible role of the VEGF-Flt-1-FAK pathway in the pathogenesis of bone destruction in GCTs Methods Patients an...
Ngày tải lên: 20/06/2014, 04:20
báo cáo hóa học:" Role of the VEGF-Flt-1-FAK pathway in the pathogenesis of osteoclastic bone destruction of giant cell tumors of bone" potx
... VEGF activates the VEGF-Flt-1-FAK pathway The activation of this signaling pathway might be involved in the migration of these cells into the lesion at the site of bone destruction in GCTs We recently ... order to determine the possible role of the VEGF-Flt-1-FAK pathway in the pathogenesis of bone destruction in GCTs Methods Patients an...
Ngày tải lên: 20/06/2014, 07:20
Báo cáo y học: "JNK pathway is involved in the inhibition of inflammatory target gene expression and NF-kappaB activation by melittin" ppsx
... [41] JNK pathway is also involved in IL-6 gene expression by enhancing NF-κB activity in human monocytes [42], as well as induction of proinflammatory responses in macrophages by the glycosylphosphatidylinositols ... region of the murine gene encoding iNOS and COX-2 contains NF-κB binding sites [15,48], which suggests that the inhibitory effect of inflamma...
Ngày tải lên: 11/08/2014, 08:22
Báo cáo y học: "EM703 improves bleomycin-induced pulmonary fibrosis in mice by the inhibition of TGF-β signaling in lung fibroblasts" doc
... significantly inhibited bleomycin-induced pulmonary fibrosis, suggesting that the mechanisms of action of EM703 against bleomycininduced pulmonary fibrosis in mice may involve not only anti-inflammatory ... significantly inhibited by EM703 (Figure 6) The mechanisms of inhibition by EM703 of bleomycininduced pulmonary fibrosis in mice may involve the i...
Ngày tải lên: 12/08/2014, 16:20
Role of misfolded nuclear receptor co repressor (n cor) induced transcriptional de regulation in the pathogenesis of acute monocytic leukemia (AML m5
... 1.2 The Nuclear Receptor Co- repressor (N- CoR), a component of the transcriptional repression machinery and its role in AML pathogenesis 1.2.1 The importance of the transcription machinery in the ... these factors become key initiators of AML pathogenesis 1.2.2 The Nuclear Receptor Co- Repressor (N- CoR) The nuclear receptor co- re...
Ngày tải lên: 09/09/2015, 18:55
Inhibition of misfolded n cor induced survival pathway in APL by artemisinin
... INHIBITION OF MISFOLDED N- COR INDUCED SURVIVAL PATHWAY IN APL BY ARTEMISININ YEO HUI LING ANGIE (B.Sc.(Hons.), NTU) A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF SCIENCE DEPARTMENT OF MEDICINE ... protein (Hsp) 70 chaperone family It consists of an N- terminal ATPase and a C-terminal substrate binding domain Conformational changes in GRP78 regulate its bind...
Ngày tải lên: 12/10/2015, 17:35