Tracking of coronary arteries in angiogram sequence by structural matching of junctions

... UNIVERSITY - HANOI COLLEGE OF FOREIGN LANGUAGES POST-GRADUATE DEPARTMENT Phạm thị phơng thúy Pragmatic Transfer in Interlanguage Requesting by Vietnamese learners of English (Nghiên cứu chuyển ... thúy Pragmatic Transfer in Interlanguage Requesting by Vietnamese learners of English (Nghiên cứu chuyển dịch ngữ dụng hành động yêu cầu liên ngôn ngời Việt...

Ngày tải lên: 07/11/2012, 14:47

Ngày tải lên: 07/11/2012, 14:47

... SC -CO2 treatment on the inactivation of coliform bacteria in untreated water is shown in Figure The coliform bacterial count in the untreated water decreased almost linearly with increasing CO2/ sample ... flow rate and exposure time in the SC -CO2 treatment on the inactivation of coliform and total bacteria in untreated water and to propose the SC -CO2...

Ngày tải lên: 05/09/2013, 09:38

... concentration of EDTA (443 μg/L) was observed in a Table - Table – Recovery of EDTA fromtap water samples and tap water Recovery of EDTA from Milli-Q water and Milli-Q water Recovery of triplicate samples ... an EDTA analytical method to the Japanese Standard Methods for the Examination of Water Occurrence of EDTA in river water samples from three r...

Ngày tải lên: 05/09/2013, 10:15

... 303-27) Tuebingen: Narr Kasper, G (1992) Pragmatic transfer Studies in Second Language Acquisition 8, 3, 203-231 Kasper, G (1995) Routine and indirectness in interlanguage pragmatics In Bouton, ... (eds.): Pragmatics and Language Learning 5, Urbana: University of Illinois at UrbanaChampaign, Division of English as an International Language Kasper, G (1995) Interlanguage Pr...

Ngày tải lên: 07/09/2013, 13:31

... capability of using language Finding and analyzing errors by learners; therefore, are significant to improve learning and teaching quality Error analysis (EA) has been defined by many linguists in different ... knowledge of reference as well as good ability to use reference as follows: An analysis of errors made by secondary- students in using personal refere...

Ngày tải lên: 18/12/2013, 10:08

... going to examine whether English language proficiency affects Vietnamese learners pragmatic transfer in requesting Besides, the influence of gender on Vietnamese learners pragmatic transfer in ... Vietnamese to English in the realization of request - the influence of English proficiency of Vietnamese learners on their pragmatic transfer from Viet...

Ngày tải lên: 05/02/2014, 22:31

... in vivo clearance and turnover of an allergen after inhalation In this study we used a novel approach for specific labelling of proteins in order to investigate how an airborne allergen, Der p 2, ... there are few data available on the fate of an allergen after inhalation In this study, we tracked inhaled Der p in vivo using the recently develo...

Ngày tải lên: 07/03/2014, 21:20

... this expression system is of interest for endogenous generation of siRNA and activation of the RNAi effect in human cells [45] Studies on an inhibition of BACE gene expression by endogenously generated ... released in neuronal cells We asked the question whether we can inhibit expression of the gene of BACE protein using our engineered ribozymes In orde...

Ngày tải lên: 08/03/2014, 08:20

... The Potential of Soil Survey Data in a Quantitative Evaluation of Surficial Geology Mapping in Northern Maine by Rosalia Evans Thesis submitted to the Eberly College of Arts and Sciences at ... derivative map This assumption may explain why Kite’s point data have poorer matches to the derivative map than the derivative map has to the point data Ki...

Ngày tải lên: 08/03/2014, 23:20

Ngày tải lên: 16/03/2014, 00:07

... TTAACCCGGGATATCCAGGTCTTCCTCACTGATCA GCTTCTGTTCCTCCATGGTGGT-3¢, and 5¢-CTAGAC CACCATGGACTACAAAGACGATGACGATAAAGAT ATCCCGGGTTAACT-3¢ and 5¢-CTAGAGTTAACCCGG GATATCTTTATCGTCATCGTCTTTGTAGTCCATGG TGGT-3¢, respectively pBOS-HA-pVHL ... oligonucleotides, 5¢-CTAGAC CACCATGTACCCCTACGACGTGCCCGACTACGCCG ATATCCCGGGTTAACT-3¢ and 5¢-CTAGAGTTAACC CGGGATATCGGCGTAGTCGGGCACGTCGTAGGGG TACATGGTGGT-3¢, into t...

Ngày tải lên: 16/03/2014, 05:20

... degradation of RNA during incubation at trans-splicing and RPA hybridization conditions Below; quantitation of RPA of trans-spliced GA mRNA generated by DiGIR2 AGU and DiGIR2DP9.2 AGU Comparative ... trans-splicing band (RNA 2) and the major GA band (RNA 3) As the amount of DiGIR2 AGU and DiGIR2DP9.2 AGU ribozymes added in the trans-splicing reactions was approximately ide...

Ngày tải lên: 23/03/2014, 13:20

... coronary sinus of Valsalva [2,7,9,10] Diagnosis and understanding of coronary artery anomalies are important in considering the severity of coronary artery stenosis, particularly during therapeutic ... Importantly, they may predispose the patient for developing an acute myocardial damage and/ or chronic injuries in the area supplied by the anomalous coronary a...

Ngày tải lên: 10/08/2014, 10:20

... TRACKING OF CORONARY ARTERIES IN ANGIOGRAM SEQUENCE BY STRUCTURAL MATCHING OF JUNCTIONS WANG YUMEI (HT080162U) (B.Sc., FUDAN UNIVERSITY, CHINA, 2008) A THESIS SUBMITTED FOR THE DEGREE OF MASTER ... performance of our algorithm 35 Figure 4.5: Tracking result in frame 32 in sequence 36 Figure 4.6: Tracking result in frame 34 in sequence 37 Figure 4.7:...

Ngày tải lên: 12/10/2015, 17:33