Local property of a class of msubharmonic functions

... Galo, I Albarreal, M.C Calzada, J.L Cruz, E Fernandez-Cara, M Mari´n, Stability and Convergence of a Parallel ´ Fractional Step Method for the Solution of Linear Parabolic Problems, Applied Mathematics ... Marszalek, Z Trzaska, A Boundary-value Problem for Linear PDAEs, Int.J.Appl.Math.Comput.Sci., Vol 12, No (2002) 487 [3] T Lu, P Neittaanmaki, X.C Tai, A Parallel Split...

Ngày tải lên: 13/02/2014, 03:20

... Annals of Mathematics, 163 (2006), 809–899 On a class of type II1 factors with Betti numbers invariants By Sorin Popa* Abstract We prove that a type II1 factor M can have at most one Cartan ... always a 2-cocycle, ∀R), there exists a type II1 factor with a Cartan subalgebra (A ⊂ M ) associated with it, via a groupmeasure space construction “` la”...

Ngày tải lên: 06/03/2014, 08:21

... F1 (ATGGAGAACTCAGT GACCCAAGATGGTAT) and 70b R1 (AGAATTCTGAG GTTGAAGAAGCTAGTAA) primers, and 70b F2 (TACT ATCAGCAGAAGCAATGTGGTGATA) and 70b R2 (TTACTGAGATGTCTTGTTCTTGGAAATGT) primers for atrpa70b ... DNA binding and chromatin association of ATR (ataxia telangiectasia-mutated and Rad3-related) in vitro via ATR interacting protein [4,22,23] Rad17 and Rad9 complexes (Rad17–RFC...

Ngày tải lên: 07/03/2014, 21:20

... Describle the local dimension for the (0, 1, a )- problem, where a ∈ N is a natural number Note that the local dimension is an important characteristic of singular measures For a = 3k + the measure ... Nguyen and T Wang, Local dimensions of the probability measure associated with the (0, 1, 3) - problem, Preprint T Hu, Some open questi...

Ngày tải lên: 14/03/2014, 13:20

... hypothesize that actinoporins act in at least two stages: (a) an initial approach to and binding of the membrane; (b) oligomerization, pore formation and lysis We also hypothesize that R29 and Y111 ... replaced by a group which is also structurally planar and able to accept and donate H-bonds In this context, our data indicate that the positive surface together with a ne...

Ngày tải lên: 14/03/2014, 23:20

... implies that MYP has a role as a zinc transporter for gametogenesis In vertebrates, vitellogenin, a precursor of yolk protein, is a zinc- bind4994 ing protein that transports the zinc required for oogenesis ... as a substrate for localization of the labeled MYP Statistical analysis Data were expressed as the mean ± SEM Statistical analysis was...

Ngày tải lên: 16/03/2014, 05:20

... processing for the tasks of document summarization (Lin and Bilmes, 2010) and word alignment (Lin and Bilmes, 2011) Submodular functions share a number of properties in common with convex and concave functions ... monotone submodular function yields a submodular function, and summing them all together retains submodularity, as mentioned in Section The monotonicity of R(S)...

Ngày tải lên: 23/03/2014, 16:20

... motivated by Ceng et al [2], Takahashi and Zembayashi [14], Takahashi and Zembayashi [9], the main aim of this paper is to introduce and investigate a new iterative method for finding a solution of ... et al Fixed Point Theory and Applications 2011, 2011:91 http://www.fixedpointtheoryandapplications.com/content/2011/1/91 Page of 11 and Takahashi [10] and Takahashi et al [13], Ta...

Ngày tải lên: 20/06/2014, 21:20

... S Aujla and F C Silva, “Weak majorization inequalities and convex functions, ” Linear Algebra and Its Applications, vol 369, pp 217–233, 2003 K Guan, “The Hamy symmetric function and its generalization,” ... Engineering, Academic Press, New York, NY, USA, 1979 19 S.-H Wu, “Generalization and sharpness of the power means inequality and their applications,” Journal of Mat...

Ngày tải lên: 22/06/2014, 02:20

... proof for part a of Theorem 1.2 by showing the following lemma 8 Journal of Inequalities and Applications Lemma 1.3 For any integer n ≥ 1, and for all x1 , , xn with each xk ∈ a, b and all ... show that this is indeed true for all admissible q, t, and x1 For the case x1 a, ψ q 1/ 1−q ta Because ta ≤ b a, ψ q ≥ 1/ b a When a < x1 ≤ b, the value of ψ q approaches...

Ngày tải lên: 22/06/2014, 03:20

... 2 A unifying approach for certain class of maximal functions 0, On the other hand, when Ω lies in Bs −1/2 (Sn−1 ), s > 1, which is a special class of block κ,υ (Sn−1 ) (see Section for the ... |x|d+1 as one of its terms By dilation invariance, we may also assume that aα = |α|=d+1 (3.6) A unifying approach for certain class of maximal functions We now choose...

Ngày tải lên: 22/06/2014, 22:20

... equations (8-17), we complete the proof Lemma 2.4 Every Witten multiple zeta value of the form ζsl(4) (a, b, 1, d, 0, 1) with a, b, d ∈ N can be expressed as a rational linear combination of ... expressed as a rational linear combination of products of single and double Euler sums of weight a + b + c Lemma 2.3 (Huard-Williams-Zhang [4]) If a, b, c be positive integers, t...

Ngày tải lên: 07/08/2014, 21:21

... obtained using the GEOPACK software (Yates and Yates, 1989) Calculations were made considering 10 lag classes using a lag spacing of 1.8 m Using these parameters, the number of pairs of points ... value of LAI on the studied site in agreement with the range of values obtained in oak coppices of southern France (Debussche et al, 1987; Pinault, 1992) It corresponded to levels...

Ngày tải lên: 08/08/2014, 18:21

... investigated intensively in recent years by many authors, see [6], [14], [24] We also recall the Cegrell classes of m-subharmonic functions Fm (Ω ) and Em (Ω ) Local property of a class of m-subharmonic ... comments that led to improvements in the exposition of the paper Local property of a class of m-subharmonic functions 23 References Bedford, E., Taylor, B...

Ngày tải lên: 12/10/2015, 10:37

... a compact subset of Ω implies that v ≤ u on Ω Local property of a class of m- subharmonic functions and applications By M SHm (Ω) we denote the set of m- maximal functions on Ω One of essential ... uj ≤ vj By Lemma 3.3 we have χ(vj )(ddc vj )m ∧ β n m sup j Ω ≤ 2m max (a, 2) sup χ(uj )(ddc uj )m ∧ β n m < +∞ j Ω Local property of a class of...

Ngày tải lên: 16/10/2015, 09:36