activity to prove angle sum property of a triangle

Tài liệu Báo cáo khoa học: Experimental proof for a signal peptidase I like activity in Mycoplasma pneumoniae, but absence of a gene encoding a conserved bacterial type I SPase pdf

Tài liệu Báo cáo khoa học: Experimental proof for a signal peptidase I like activity in Mycoplasma pneumoniae, but absence of a gene encoding a conserved bacterial type I SPase pdf

... if at all, affected by these two reactions. Two amino acid modifications were detected: tryptophan 248 was oxidized to a minor extent and asparagine 205 was, to some extent, con- verted to aspartic ... M. pneumoniae, although a SPase I activity has been shown to be essential for cell viability in all bacteria analyzed [26]. To test experimentally whether there is a type I SPase activity in ... pathogenic bac- terium [1,2], characterized by a small genome of 816 kbp [3], the lack of a bacterial cell wall and a parasitic lifestyle [4]. Some species of the genus mycoplasma, e.g. Myco- plasma genitalium,...

Ngày tải lên: 19/02/2014, 18:20

9 559 1
Báo cáo khoa học: Evolutionary changes to transthyretin: structure and function of a transthyretin-like ancestral protein doc

Báo cáo khoa học: Evolutionary changes to transthyretin: structure and function of a transthyretin-like ancestral protein doc

... hydantoinase, allantoinase and dihydrooratase [32]. Cyclic amidohydrolases share a number of physicochemical characteristics. These characteristics include quaternary, tertiary, secondary and ... 0 Loktanella vestfoldensis SKA53 Proteobacteria, Alphaproteobacteria 2 0 Roseovarius sp. HTCC2601 Proteobacteria, Alphaproteobacteria 2 0 Ralstonia eutropha H16 Proteobacteria, Betaproteobacteria ... decarboxyl- ation of OHCU to (S)-allantoin. Thus, the pathway of the conversion of uric acid to (S)-allantoin via the three enzymes uricase, TLP (5-HIUase) and OHCU decar- boxylase was revealed...

Ngày tải lên: 07/03/2014, 00:20

13 390 0
Báo cáo khoa học: "Techniques to incorporate the benefits of a Hierarchy in a modified hidden Markov model" pptx

Báo cáo khoa học: "Techniques to incorporate the benefits of a Hierarchy in a modified hidden Markov model" pptx

... Hierarchy in a modified hidden Markov model Lin-Yi Chou University of Waikato Hamilton New Zealand lc55@cs.waikato.ac.nz Abstract This paper explores techniques to take ad- vantage of the fundamental difference ... obser- vations (Rabiner and Juang, 1986). They have proven to be capable of assigning semantic la- bels to tokens over a wide variety of input types. 1 The 2004 Conference on Computational Natural Lan- guage ... second dataset is part of the Lancaster Treebank corpus and contains 1473 sentences. Each sentence con- tains hand-labeled syntactic roles for natural lan- guage text. A. 200 A. 400 A. 600 A. 800 A. 1000 A. 1200 A. 1400 0.86 0.88 0.90 0.92 0.94 B.200 B.400 B.600 B.800 B.1000 B.1200 B.1400 0.86 0.88 0.90 0.92 0.94 0.86 0.88 0.90 0.92 0.94 F C.200 C.400 C.600 C.800 C.1000 C.1200 C.1400 0.86 0.88 0.90 0.92 0.94 0.86 0.88 0.90 0.92 0.94 F Figure...

Ngày tải lên: 08/03/2014, 02:21

8 528 0
Báo cáo khoa học: The use of recombinant protein and RNA interference approaches to study the reproductive functions of a gonad-stimulating hormone from the shrimp Metapenaeus ensis ppt

Báo cáo khoa học: The use of recombinant protein and RNA interference approaches to study the reproductive functions of a gonad-stimulating hormone from the shrimp Metapenaeus ensis ppt

... RNAi To prepare a DNA template for the synthesis of dsRNA, DNA corresponding to the mature peptide of MeMIH-B was amplied by PCR using T7 promoter-linked primers (forward, 5Â-TAATACGACTCACTATAGGTACTATG TATCGCATGCCAAT-3Â; ... primers (forward, 5Â-TAATACGACTCACTATAGGTACTATG TATCGCATGCCAAT-3Â; reverse, 5Â-TAATACGACTC ACTATAGGTACTTTAAAGTCCCGGGTTGA-3Â). For PCR, the reaction mix consisted of 1 Ã Taq buffer contain- ing 1.5 mm MgCl 2 , ... Morera Y, Rodriguez T, Huberman A, Ramos L & Estrada MP (2006) Molecular cloning and characterization of the crustacean hyperglycemic hor- mone cDNA from Litopenaeus schmitti. Functional analysis...

Ngày tải lên: 16/03/2014, 05:20

11 546 0
Testing Costs and Testing Capacity According to the REACH Requirements – Results of a Survey of Independent and Corporate GLP Laboratories in the EU and Switzerland potx

Testing Costs and Testing Capacity According to the REACH Requirements – Results of a Survey of Independent and Corporate GLP Laboratories in the EU and Switzerland potx

... summarized the average and maximum testing capacity in appendix 2. The ratio of the maximum capacity to the average capacity available is about 2.5. Again, this indicates that the average capacity ... large lab). The size of the small labs might be related to comparative advantage. E.g. the price advantages of the small labs might be due to advantages of specialization. Small labs generally ... incorporates all the relevant data. However, there is no general standard for an acceptable level of price variability. Thus, we had to fix a reasonable boundary. The ratio mean to median of a sample...

Ngày tải lên: 23/03/2014, 05:22

19 493 1
Báo cáo khoa học: Common mode of DNA binding to cold shock domains Crystal structure of hexathymidine bound to the domain-swapped form of a major cold shock protein from Bacillus caldolyticus pot

Báo cáo khoa học: Common mode of DNA binding to cold shock domains Crystal structure of hexathymidine bound to the domain-swapped form of a major cold shock protein from Bacillus caldolyticus pot

... model of amyloid protofilament formation may also be relevant for the CSP and may explain why a bipartite organization can be observed in the late stage of Ec-CspA amyloidogenesis [28]. To form extended ... can now define a com- mon interaction interface that allows us to understand A B Fig. 4. Binding of hexathymidine to amphipathic platforms of a Bc- Csp swapped dimer. (A) Topological representation ... Mutational analysis of the puta- tive nucleic acid-binding surface of the cold-shock domain, CspB, revealed an essential role of aromatic and basic residues in binding of single-stranded DNA containing...

Ngày tải lên: 23/03/2014, 09:21

15 333 0
Báo cáo khoa học: "From RAGS to RICHES: exploiting the potential of a flexible generation architecture" pot

Báo cáo khoa học: "From RAGS to RICHES: exploiting the potential of a flexible generation architecture" pot

... Generation, commonly viewed as a single task, needs to have access to at least rhetorical and document information as well as referencing and adding to the syntactic information. To accommodate ... Rosner, and O. Stock, editors, Aspects of Au- tomated Natural Language Generation, number LNAI- 587. Springer-Verlag. B. Lavoie and O. Rambow. 1997. A fast and portable re- alizer for text generation ... communicate exclu- sively via the OASYS server. The O /A data representation is a simple typed network representation language. An O /A database consists of a collection of objects, each of which has a...

Ngày tải lên: 31/03/2014, 04:20

8 368 0
peer-to-peer harnessing the benefits of a disruptive technology

peer-to-peer harnessing the benefits of a disruptive technology

... What do we mean by metadata? In the case of Napster, metadata means the combination of artist and song names that users search for. It also includes additional data managed by the central Napster ... DNS are directly applicable to contemporary peer -to- peer data sharing applications. DNS was established as a solution to a file-sharing problem. In the early days of the Internet, the way to ... application that is transmitting bulk data; it would be a significant advance to make sure that a program does not have to retransmit or resend data to another host. Caching is a well understood technology:...

Ngày tải lên: 01/06/2014, 10:58

265 535 0
Báo cáo sinh học: " Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" pot

Báo cáo sinh học: " Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" pot

... used. To monitor the presence of TULV S RNA on passages, RT-PCR was performed with primers VF738 (5'GCCTGAAAAGATTGAGGAGTTCC3'; nt 738–760) and VR855 (5'TTCACGTCCTAAAAGGTAAGCATCA3'; ... Pejcoch M, Niemimaa J, Kaikusalo A, Henttonen H, Vaheri A, Plyusnin A: Isolation and characterization of Tula virus: a distinct serotype in genus Hantavirus, family Bunya- viridae. J Gen Virol ... presence of the Monitoring of wt and recS-RNA during sequential passages of the mixture of TUL02 and recTULVFigure 2 Monitoring of wt and recS-RNA during sequential passages of the mixture of TUL02 and...

Ngày tải lên: 18/06/2014, 22:20

5 483 0
báo cáo hóa học:" Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" ppt

báo cáo hóa học:" Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" ppt

... passages, RT-PCR was performed with primers VF738 (5'GCCTGAAAAGATTGAGGAGTTCC3'; nt 738–760) and VR855 (5'TTCACGTCCTAAAAGGTAAGCATCA3'; nt 831–855). To monitor the presence of ... presence of recS-RNA on the passages was mon- itored by RT-PCR and the isolate appeared to have a stable genotype (data not shown). RecTULV formed foci similar in size to those of the original variant ... Pejcoch M, Niemimaa J, Kaikusalo A, Henttonen H, Vaheri A, Plyusnin A: Isolation and characterization of Tula virus: a distinct serotype in genus Hantavirus, family Bunya- viridae. J Gen Virol...

Ngày tải lên: 20/06/2014, 04:20

5 430 0
Báo cáo hóa học: " Development and application of a biomarker assay for determining the pharmacodynamic activity of an antagonist candidate biotherapeutic antibody to IL21R in whole blood" pptx

Báo cáo hóa học: " Development and application of a biomarker assay for determining the pharmacodynamic activity of an antagonist candidate biotherapeutic antibody to IL21R in whole blood" pptx

... housed and cared for according to the American Association for Accreditation of Laboratory Animal Care guidelines. The Wyeth Institutional Animal Arai et al. Journal of Translational Medicine 2010, ... that identified the candidate biomarkers, and they participated in the data analyses. AAH developed the customized Spotfire tool used for data analyses and reviewed statistical analyses. YG participated ... 8:647-653. 6. Ray CA, Dumaual C, Willey M, Fill J, O'Brien PJ, Gourley I, Devanarayan V, Konrad RJ: Optimization of analytical and pre-analytical variables associated with an ex vivo cytokine...

Ngày tải lên: 18/06/2014, 16:20

13 529 0
w