Indentation studies on a zr based bulk metallic glass

... anneal the metallic glass To investigate the effect of quasi-static deformation on nanocrystallization behaviour in the shear bands, they conducted nanoindentation experiments on metallic glass Zr5 2.5Cu17.9Ni14.6Al10Ti5 ... 2.6.3 Indentation Investigation on Metallic Glasses Indentation may introduce a constrained or stable stress field and thus provides a way to cha...

Ngày tải lên: 09/10/2015, 11:24

... framework for finding object-oriented information in unstructured data Two above solutions can be plausible for solving object search problem Yet, the Information Extraction based solution has ... they also have some shortcomings Information Extraction based solution has low scalability and low adaptability while Text Information Retrieval based solution has high sca...

Ngày tải lên: 23/11/2012, 15:04

... template using Deep Vent DNA polymerase (New England Biolabs, Ipswich, MA, USA), a sense primer (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG ... Salmonella typhimurium SurE A Pappachan et al phase and under conditions of high temperature and high salt compared with parent strains that had the intact surE gene [1] Th...

Ngày tải lên: 18/02/2014, 14:20

... Part of a two-dimensional 1H,13C HSQC spectrum of the O-specific polysaccharide (OPS) of Citrobacter braakii PCM 1531 One-dimensional 1H and 13C NMR spectra are displayed along the horizontal and ... immunodiffusion of anti (Citrobacter braakii PCM 1531) serum (A) and anti- (Citrobacter PCM 1487) serum (B) with lipopolysaccharide (LPS)-I (well 1) and...

Ngày tải lên: 23/03/2014, 17:22

... to a variety of fungal, bacterial, protozoal and viral diseases Species of Candida, Coccidioides, Histoplasma, and Aspergillus are important causative agents Of these, Candida species, especially ... can be isolated separately and are designated as type II FAS enzymes In contrast, mammalian FAS are large multifunctional proteins and are designated as type I FAS enzymes Various intermediate...

Ngày tải lên: 07/10/2015, 10:02

... Background and literature review 2.1 Metallic glass and glass forming ability 2.2 Mechanical properties of Bulk Metallic glass and Bulk metallic glass composites 2.3 Applications ... models to describe the large deformation behavior of Bulk Metallic Glass (BMG) composites at room and high homologous temperatures, as well as at different strain...

Ngày tải lên: 09/09/2015, 10:06

... and H J Gao An instability index of shear band for plasticity in metallic glasses Acta Materialia, 2009, 57: 1367 Z Han and Y Li Cooperative shear and catastrophic fracture of bulk metallic glasses ... updated this map in terms of bulk metallic glass instead of amorphous ribbons In this thesis, we only focus on the region of inhomogeneous deformation of bulk...

Ngày tải lên: 14/09/2015, 08:43

... [10] N Moraitis and P Constantinou, Indoor channel measurements and characterization at 60 GHz for wireless local area network applications,” IEEE Transactions on Antennas and Propagation, vol ... Selected Areas in Communications, vol 20, no 3, pp 620–630, 2002 [3] T Manabe, Y Miura, and T Ihara, “Effects of antenna directivity and polarization on indoor multipath propagation...

Ngày tải lên: 22/06/2014, 22:20

... coefficient of consolidation and end of primary settlement based on a direct solution of the Terzaghi theory This new method determines the coefficient of consolidation utilizing the entire range of consolidation ... study confirms that the identification of the experimental range of primary consolidation that corresponds to the Terzaghi theo...

Ngày tải lên: 21/03/2013, 14:09

... to make this approach applicable to conventional transmissions, a many-gear transmission concept has been established Fuel economy and gear shifting effects Many approaches are known as feasible ... Lechner G et al, Automotive Transmission, Springer publication,1994 Notations and abbreviations AMT Automated Manual Transmission AT Automatic Transmission CVT Continuously Variable Tran...

Ngày tải lên: 05/09/2013, 17:03

... optical data storage, ultrafast optical communication, as well as biological/chemical sensing and imaging in the visible and infrared spectral regions ) Figure Anisotropic laser emission (a) Variation ... and preparation procedures, optical measurement setups, numerical simulation method, as well as additional experimental data This material is available free of charge via the Internet at htt...

Ngày tải lên: 18/09/2013, 21:26

... crystals of the ternary complex of S cerevisiae ArgRS, Arg and tRNAArgICG grow contains tRNA, l -Arg, ATP and Mg2+ at sufficient concentrations for the aminoacylation reaction, and (NH4)2SO4 and ... no means in a conformation that is fit to activate The fact that kcat and Km for tRNAArg in the aminoacylation reaction not change in the Asn106 fi Ala, Gln111 fi Ala and Phe10...

Ngày tải lên: 18/02/2014, 11:20

... 2002 Dialog Navigator : A Question Answering System based on Large Text Knowledge Base In Proceedings of COLING 2002, pages 460–466 Sadao Kurohashi and Makoto Nagao 1994 A syntactic analysis ... recognition After that, the system retrieves relevant texts in the text knowledge base using each candidate, and makes confirmation based on significance for retrieval Co...

Ngày tải lên: 20/02/2014, 16:20

... anchor, all leaves of fragments are negative, and internal node variables are neutral This guarantees that in a saturated model, tree fragments that belong to the denotation of distinct tree descriptions ... propositions are instantiated A free variable is instantiated as follows: each free variable labels a syntactic node variable and is unied with the label of any node variable...

Ngày tải lên: 20/02/2014, 18:20

... better consideration in health care programs for the elderly, Lima et al • Chronic diseases and quality of life among elderly in Brazil such as the negative impact on the vitality and general health ... Lima et al • Chronic diseases and quality of life among elderly in Brazil Noncommunicable chronic diseases are conditions that tend to stay with indi...

Ngày tải lên: 05/03/2014, 21:20