Identification of pluripotency genes in the fish medaka

Identification of pluripotency genes in the fish medaka

Identification of pluripotency genes in the fish medaka

... examine the timing of zygotic expression of six pluripotency genes by determining their expression from the paternal alleles All those genes showed the onset of zygotic expression around the ... ability These stem cells present in tissues of the three germ layers cannot generate cells of other tissues within the same germ layer or of the other germ layers, bu...

Ngày tải lên: 09/10/2015, 10:49

95 394 0
Identification of factors involved in the maintenance of embryonic stem cell self renewal and pluripotency 2

Identification of factors involved in the maintenance of embryonic stem cell self renewal and pluripotency 2

... 2. 1 ES cell secretion of LEFTY2 maintains pluripotency 2. 1.1 Introduction The molecular basis of self- renewal and the maintenance of pluripotency in ES cells have yet to be ... secreted into and deposited in the ES cell microenvironment 79 2. 1 .2. 8 LEFTY2 maintains ES cell self renewal by inhibiting Nodal signaling Next, the mechanism of LEFT...

Ngày tải lên: 11/09/2015, 16:02

117 415 0
Identification of factors involved in the maintenance of embryonic stem cell self renewal and pluripotency 3

Identification of factors involved in the maintenance of embryonic stem cell self renewal and pluripotency 3

... signals dictate embryonic stem cell fates is also not entirely clear Conflicting roles of Nodal signaling in both the maintenance of ES cell self renewal and induction of ES cell differentiation ... be learnt The primary aim of this project hence serves to identify and delineate the roles of additional factors and pathways that are important for the...

Ngày tải lên: 11/09/2015, 16:02

4 185 0
Identification of factors involved in the maintenance of embryonic stem cell self renewal and pluripotency 4

Identification of factors involved in the maintenance of embryonic stem cell self renewal and pluripotency 4

... to fixing in 4% formaldehyde for 1min Before the stain solution was added, the cells were again rinsed thrice with PBS to remove the fixative The samples were then incubated for 15min in the dark ... induction, the drug was removed from the cells by changing the culture medium The E14tg2a cells were fed daily with fresh medium containing no Doxycyclin 4. 14. 1.3 Treatm...

Ngày tải lên: 11/09/2015, 16:02

24 298 0
Identification of factors involved in the maintenance of embryonic stem cell self renewal and pluripotency 5

Identification of factors involved in the maintenance of embryonic stem cell self renewal and pluripotency 5

... Bucay, N., Hinton, A., Firpo, M T., King, C C., and Hayek, A (20 05) Activin A maintains pluripotency of human embryonic stem cells in the absence of feeder layers Stem Cells 23, 489-4 95 Besser, ... H., and Miyazono, K (2007) Activin-Nodal signaling is involved in propagation of mouse embryonic stem cells J Cell Sci 120, 55 - 65 Oh, S P., and Li, E (1997)...

Ngày tải lên: 11/09/2015, 16:02

13 229 0
Identification of factors involved in the maintenance of embryonic stem cell self renewal and pluripotency

Identification of factors involved in the maintenance of embryonic stem cell self renewal and pluripotency

... the unleashing of the immense potential of ES cells is however the current incomplete understanding of the molecular mechanism underlying self renewal and cell fate determination of ES cells 1.2 ... pluripotent embryonic stem (ES) cell lines The derivation of pluripotent cell lines from blastocysts was first achieved in the murine system in 1981 by Ma...

Ngày tải lên: 11/09/2015, 16:02

41 312 0
Appendix  identification of factors involved in the maintenance of embryonic stem cell self renewal and pluripotency

Appendix identification of factors involved in the maintenance of embryonic stem cell self renewal and pluripotency

... protein Member of TGFsuperfamily Involved in Nodal signaling Nodal antagonist • • • • • Rex2 • Zinc finger protein • • • Zfx • • • a-catenin • Zinc finger protein Transcription factor Link to ... -catenin (Catnb) Dot1l Lef1 Gata3 • • • • • • • • complex Involved in Wnt signaling Subunit of Cadherin protein complex Intracellular mediator of canonical Wnt signaling Non-SET domain...

Ngày tải lên: 11/09/2015, 16:03

12 183 0
Báo cáo hóa học: " First identification of primary nanoparticles in the aggregation of HMF" potx

Báo cáo hóa học: " First identification of primary nanoparticles in the aggregation of HMF" potx

... cross-linked furanic species The continued growth in size of the cross-linked furanic species eventually results in the precipitation of the molecular clusters out of the solution into the primary ... participated in the data analysis and drafting of the manuscript XDS contributed in the planning of the experimental program and in discussing of carb...

Ngày tải lên: 20/06/2014, 23:20

13 473 0
báo cáo hóa học:" First identification of primary nanoparticles in the aggregation of HMF" doc

báo cáo hóa học:" First identification of primary nanoparticles in the aggregation of HMF" doc

... cross-linked furanic species The continued growth in size of the cross-linked furanic species eventually results in the precipitation of the molecular clusters out of the solution into the primary ... and in drafting of the manuscript YNL is the cosupervisor who participated in the data analysis and drafting of the manuscript XDS contributed in the...

Ngày tải lên: 21/06/2014, 17:20

5 304 0
Scientific report: "Application of PCR to detect the presence of two genes in the genome of rice AtAOS has been genetically modified" pdf

Scientific report: "Application of PCR to detect the presence of two genes in the genome of rice AtAOS has been genetically modified" pdf

... microbody (MB), mitochondria (MC) In order to increase the level of endogenous JA in rice, we try to over express AOS genes by transforming AtAOS2 gene to the rice genome Fig The octadecanoid ... transgenic rice genome The results of PCRs would confirm the appearance of the AtAOS2 gene in the transgenic rice genome MATERIALS AND METHODS 2.1 Ext...

Ngày tải lên: 06/08/2014, 18:21

8 406 0
Báo cáo y học: "The role of structural genes in the pathogenesis of osteoarthritic disorder" potx

Báo cáo y học: "The role of structural genes in the pathogenesis of osteoarthritic disorder" potx

... [23], linkage analysis of 14 candidate genes in OA kindreds resulted in the exclusion of 10 important cartilage genes, including COL2A1 [40] Analysis of 47 families with the phenotype of earlyonset ... epiphyseal dysplasias (MEDs), and the metaphyseal chondrodysplasias They are usually inherited as fully penetrant autosomal dominant disorders The expression of the O...

Ngày tải lên: 09/08/2014, 06:22

9 404 0
Báo cáo y học: " Identification of fusion genes in breast cancer by paired-end RNA-sequencing" potx

Báo cáo y học: " Identification of fusion genes in breast cancer by paired-end RNA-sequencing" potx

... ZNF704 14 14 Yes Yes No No Yes 3 Yes Yes Yes SK-BR-3 CYTH1 SK-BR-3 DHX35 17 20 EIF3H ITCH 20 38 2 Yes Yes Yes No Yes Yes Yes SK-BR-3 NFS1 20 PREX1 20 Yes KPL-4 BSG 19 NFIX 19 22 14 Yes No Yes KPL-4 ... number of validated expressed fusion genes reported in breast cancer cells so far This indicates the power of transcriptomic profiling by next-generation sequencing in that it...

Ngày tải lên: 09/08/2014, 22:23

13 440 0
Báo cáo y học: " Comparison of the expression of cytokine genes in the bursal tissues of the chickens following challenge with infectious bursal disease viruses of varying virulence" pps

Báo cáo y học: " Comparison of the expression of cytokine genes in the bursal tissues of the chickens following challenge with infectious bursal disease viruses of varying virulence" pps

... Liu et al.: Comparison of the expression of cytokine genes in the bursal tissues of the chickens following challenge with infectious bursal disease viruses of varying virulence Virology Journal ... difference in the expression levels of cytokines was possibly influenced by the different degree of viral replication However, factors infl...

Ngày tải lên: 11/08/2014, 21:21

9 387 0
báo cáo khoa học: " Identification of flowering genes in strawberry, a perennial SD plant" potx

báo cáo khoa học: " Identification of flowering genes in strawberry, a perennial SD plant" potx

... SVP SPY GA3ox GA2ox TFL1 AP2 CAGACCAGCAGAGGCTTATCTT CGGCATTACGTTCACTGCTA CAGGTGAGGCGGATAGAGAA CGCTCCAGAAGAAGGATAAGG TCTGAAGCACGTAAGGTCTA AAAGCTGGAGAAGGAGGCAGTC TGCATGGGGTAGTGAAACAA ACCCACATCGTTTGTGGTCT ... AGCCCTTGATGTCATCAGCTG TCTCCACACCTTTGATTGCCA GGAGAGCCAGAACCAGGAG GATCCAGCAGCAACCAAGTCTC CGTGCTAAGGCAGATGAATGG TGCGGTGTCAAATTGCATCA CCTCACAATCATCCACCAATCC CACCATGCCCAGAGCTTCA TGCAGAAACAAACGAG...

Ngày tải lên: 12/08/2014, 03:21

16 365 0
báo cáo khoa học: " Complete plastid genome sequences suggest strong selection for retention of photosynthetic genes in the parasitic plant genus Cuscuta" ppt

báo cáo khoa học: " Complete plastid genome sequences suggest strong selection for retention of photosynthetic genes in the parasitic plant genus Cuscuta" ppt

... test whether genes remaining in the plastid of the fully nonphotosynthetic Epifagus are under less constraint than those of the putatively photosynthetic Cuscuta species Surprisingly, among the alignable ... free-living seedlings may explain the need for an intact photosynthetic apparatus in this parasitic lineage Use of RuBisCo for lipid biosynthesis may als...

Ngày tải lên: 12/08/2014, 05:20

22 276 0
Từ khóa:
w