Genetic studies on a soil streptomyces sp that produces an antifungal compoud

... to a variety of fungal, bacterial, protozoal and viral diseases Species of Candida, Coccidioides, Histoplasma, and Aspergillus are important causative agents Of these, Candida species, especially ... can be isolated separately and are designated as type II FAS enzymes In contrast, mammalian FAS are large multifunctional proteins and are designated as type I FAS enzymes Various intermediate...

Ngày tải lên: 07/10/2015, 10:02

... framework for finding object-oriented information in unstructured data Two above solutions can be plausible for solving object search problem Yet, the Information Extraction based solution has ... they also have some shortcomings Information Extraction based solution has low scalability and low adaptability while Text Information Retrieval based solution has high sca...

Ngày tải lên: 23/11/2012, 15:04

... template using Deep Vent DNA polymerase (New England Biolabs, Ipswich, MA, USA), a sense primer (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG ... Salmonella typhimurium SurE A Pappachan et al phase and under conditions of high temperature and high salt compared with parent strains that had the intact surE gene [1] Th...

Ngày tải lên: 18/02/2014, 14:20

... Part of a two-dimensional 1H,13C HSQC spectrum of the O-specific polysaccharide (OPS) of Citrobacter braakii PCM 1531 One-dimensional 1H and 13C NMR spectra are displayed along the horizontal and ... immunodiffusion of anti (Citrobacter braakii PCM 1531) serum (A) and anti- (Citrobacter PCM 1487) serum (B) with lipopolysaccharide (LPS)-I (well 1) and...

Ngày tải lên: 23/03/2014, 17:22

... anneal the metallic glass To investigate the effect of quasi-static deformation on nanocrystallization behaviour in the shear bands, they conducted nanoindentation experiments on metallic glass Zr5 2.5Cu17.9Ni14.6Al10Ti5 ... 2.6.3 Indentation Investigation on Metallic Glasses Indentation may introduce a constrained or stable stress field and thus provides a way to cha...

Ngày tải lên: 09/10/2015, 11:24

... substrate recognition For the superposition of the substrate- free PhyK with substrate- free ˚ AppA the Ca atoms are 2.41 A apart, whereas for the substrate- free PhyK and the substrate- loaded AppA ... B Fig Crystal structure of Klebsiella sp ASR1 phytase (A) Cartoon representation showing the two domains of PhyK, the a domain (orange) and the a ⁄...

Ngày tải lên: 16/02/2014, 09:20

... ensure the generation of the ketone The ability of ScPDC and ZmPDC to decarboxylate indolepyruvate was examined under the same conditions In the case of ZmPDC maximum enzyme concentration was 2.3 ... independent of the concentration of the auxiliary enzyme, confirming that the coupled assay monitors the true rate of EcIPDC catalysis Figs and and Table illustr...

Ngày tải lên: 08/03/2014, 02:20

... Function of SP isoform of type III AFP M Takamichi et al isoforms with respect to the TH value has been identified [6–8] For example, an AFGP based on a repetitive polypeptide consisting of Thr–Ala–Ala ... successive stacking of hexagonal ice plates on the basal plane, leading to the formation of an ice bipyramid, as illustrated in Fig When pyramidal planes are created...

Ngày tải lên: 16/03/2014, 04:20

... that the Kdn-containing polymer, along with teichuronic and teichoic acids is a constituent of the cell wall of plant pathogenic strain Streptomyces sp VKM Ac-2124, which is phylogenetically the ... of the total cell wall preparation was determined by its transformation in 2-octyl glycoside and by comparison of the derivative obtained with s...

Ngày tải lên: 17/03/2014, 10:20

... in this work (A) Consecutive additions of GlcNAc and Gal to Galb1-4GlcNAcb-pNP by b3GnT and b4GalT (B) Consecutive additions of GlcNAc and Gal to Galb1-4Glcb-pNP by b3GnT and b-D-galactosidase ... of that of The same tendency was seen in a comparison of and This was also the case for B fragilis endo-b-galactosidase as shown in Table Transglycosylation reaction o...

Ngày tải lên: 31/03/2014, 07:20

... [10] N Moraitis and P Constantinou, Indoor channel measurements and characterization at 60 GHz for wireless local area network applications,” IEEE Transactions on Antennas and Propagation, vol ... Selected Areas in Communications, vol 20, no 3, pp 620–630, 2002 [3] T Manabe, Y Miura, and T Ihara, “Effects of antenna directivity and polarization on indoor multipath propagation...

Ngày tải lên: 22/06/2014, 22:20

... loading rate and sawdust additions on row crop yield and nitrate leaching potentials in Virginia sand and gravel mine reclamation Land Reclamation – A Different Approach In: Proceedings 18th National ... PIETRZYKOWSKI M., KRZAKLEWSKI W., 2007 Soil organic matter, C and N accumulation during natural succession and reclamation in an opencast sand quarry (southern Pol...

Ngày tải lên: 07/08/2014, 10:22

... larger differences among the sites than actually exist in the main rooting horizon A major disadvantage of our study is the lack of appropriate data on N availability in the soils Although N mineralization ... in the basic calcareous substrates than in the acidic sandstone and sandy soils (Tab III) The pool of exchangeable Ca + Mg + K in the mineral topsoil...

Ngày tải lên: 08/08/2014, 00:22

... root zone, Wm is the minimum soil water (i.e lower limit of water availability) , WFC is the soil water content at field capacity 2.2 Calculation of canopy conductance Canopy conductance for water ... have demonstrated the negative effect of soil water depletion on canopy conductance Variation of gc can be related either to predawn water potential as i...

Ngày tải lên: 08/08/2014, 14:22