Formation of ultra shallow junctions in silicon germanium by pulsed laser annealing
Formation of ultra shallow junctions in silicon germanium by pulsed laser annealing
... process windows Laser annealing offers several advantages over conventional processing techniques: 1) the junction depth is defined by the amorphous/crystalline interface Laser annealing, combined ... and ultra- shallow junctions The degree of melting is determined by the extent of laser absorption and rate of heat dissipation, which are dependent on the substrate prop...
Ngày tải lên: 06/10/2015, 21:15
Defect engineering in the formation of ultra shallow junctions for advanced nano metal oxide semiconductor technology
... DEFECT ENGINEERING IN THE FORMATION OF ULTRA- SHALLOW JUNCTIONS FOR ADVANCED NANO- METAL- OXIDESEMICONDUCTOR TECHNOLOGY YEONG SAI HOOI (B Eng (Hons.), NUS) A THESIS SUBMITTED FOR THE DEGREE OF ... USJs for the application in nano- CMOS devices through the understanding and maneuvering of dopant -defect interactions, known as defect engineering T...
Ngày tải lên: 11/09/2015, 09:58
Fabrication of ultra shallow junctions and advanced gate stacks for ULSI technologies using laser thermal processing
... FABRICATION OF ULTRA- SHALLOW JUNCTIONS AND ADVANCED GATE STACKS FOR ULSI TECHNOLOGIES USING LASER THERMAL PROCESSING CHONG YUNG FU (B A Sc (First Class Hons.), NTU) A THESIS SUBMITTED FOR ... fabricate ultra- shallow p+/n junctions and advanced poly-Si gate stacks for ultra- large scale integration technologies LTP of ultra- shallow ju...
Ngày tải lên: 12/09/2015, 11:29
Theoretical study of elementary processes in silicon germanium epitaxial growth on SI(100) and SI1 xGEx (100) surfaces
... involving in silicon and silicon- germanium epitaxial growth on Si(100) and Si1- xGex( 100) surface are investigated at atomic level using first principle density functional theory(DFT) calculations and ... transition state 12 Introduction 1.1 Silicon and germanium in semiconductor 1.1.1 Silicon and silicon- germanium devices Silicon, the second richest...
Ngày tải lên: 13/09/2015, 19:51
Formation of Aerobic Granular Sludge in a Continuous-Flow Reactor – Control Strategy for the Selection of Well-Settling Granular Sludge
... Formation of Aerobic Granular Sludge Two AUFB reactors were used for the formation of aerobic granular sludge Air was introduced from the bottom of the reactor, and aeration rate was gradually increased ... in a continuous-flow reactor Both surface loading and aeration rates affect the selection of well-settling sludge and the formation of...
Ngày tải lên: 05/09/2013, 10:15
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
... GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The resulting PCR products, ... [15] Metabolic control analysis has helped us to characterize the role of the individual genes in an operon and, to some extent, explain why L lactis may...
Ngày tải lên: 19/02/2014, 17:20
A study on formation of adjectives from nouns in English
... this study only takes my investigation in one small part of adjective formation, that is ‚adjective formation from nouns In the study, I give analysis about the formation of adjective from nouns, ... understanding and using adjectives formed from nouns Scope of the study Although adjective and its formation is interesting subject, attracting my attention, due...
Ngày tải lên: 18/03/2014, 10:15
The formation of the plural noun in English and Vietnamese equivalents
... compare the differences between the formation of plural nouns in English and in Vietnamese 36 Chapter two :The formation of plural nouns in English and Vietnamese equivalents In English, the English ... reference books and on the internet to select the valuable information relating to the theme the forming of the plural nouns in E...
Ngày tải lên: 19/03/2014, 17:10
Báo cáo hóa học: " The Characteristics of Seebeck Coefficient in Silicon Nanowires Manufactured by CMOS Compatible Process" pptx
... n-/p-type silicon nanowires The defined minimum width of silicon nanowire is 30 nm The electrical conductivities of n-/p-leg nanowires are extracted with the variation of width Using this structure, Seebeck ... -94 lV/K depending on the width In p-leg, Seebeck coefficient (ap) varies from 108 to 122 lV/K In the case of serial connection between n-leg and p-le...
Ngày tải lên: 21/06/2014, 17:20
Báo cáo hóa học: " Outage Analysis of Ultra-Wideband System in Lognormal Multipath Fading and Square-Shaped Cellular " ppt
... Spain, September 2004 [9] P Pirinen, “Ultra wideband system outage studies in a square cell with partial rake receiver and lognormal fading, ” in Proceedings of IEEE International Conference on Ultra-Wideband ... “Performance of RAKE reception for ultra wideband signals in a lognormalfading channel,” in Proceedings of International Workshop on Ultra Wideband Systems (...
Ngày tải lên: 22/06/2014, 22:20
báo cáo khoa học: " New insight into the structures and formation of anthocyanic vacuolar inclusions in flower petals" potx
... anthocyanin-containing pro -vacuolar vesicles being formed at the site of anthocyanin biosynthesis, which then bud off the ER and fuse with the tonoplast With regard to the fate of the anthocyanins ... vesicles into AVI-like structures that contained the spread of anthocyanins from the inclusions into the vacuolar sap However, light incidence is likely to be...
Ngày tải lên: 12/08/2014, 05:20
Báo cáo y học: " Mathematical model of blunt injury to the vascular wall via formation of rouleaux and changes in local hemodynamic and rheological factors. Implications for the mechanism of traumatic myocardial infarction" pot
... blood flow and located in the "hemodynamic shade" of the original attached rouleaux The escalating formation of rouleaux continues within the entire "hemodymanic shade" zone The model of traumatic ... understanding of the mechanism of blunt trauma to the vascular wall, which takes into account local hemodynamic and rheological factors, c...
Ngày tải lên: 13/08/2014, 22:22
Carbon rich silicon (si1 ycy)for defect engineering of ion implantation damage in devices activated by solid phase epitaxy
... CHARACTERIZATION OF CARBON IN SILICON 38 3.1 38 Carbon in silicon 3.1.1 Epitaxy Incorporation of carbon 3.1.2 Maximizing substitutional carbon incorporation 3.2 Quantification of the carbon content ... suppression of boron diffusion [19-21] and elimination of implantation EOR defects [22, 23] in the presence of carbon The combined effects of dopant diff...
Ngày tải lên: 12/09/2015, 09:28
Molecular mechanisms underlying the regulation of the positioning and formation of the cleavage furrow in cytokinesis in mammalian cells
... spatial and temporal resolution In this thesis, I have studied the molecular mechanisms that regulate the determination of the position of the cleavage furrow and the cleavage furrow formation in cytokinesis ... action Inhibit myosin II ATPase activity by binding to myosin II-ADP-Pi Blebbistatin and inhibit the release of the ADP Inhibit actin pol...
Ngày tải lên: 14/09/2015, 14:09