Formation of salmonella typhimurium biofilm under various growth conditions and its sensitivity to industrial sanitizers
Formation of salmonella typhimurium biofilm under various growth conditions and its sensitivity to industrial sanitizers
... 4-2: Sensitivity of Salmonella biofilms formed under various conditions to mixed peroxyacetic acid/organic acid (0.1%) 61 Table 4-3: Sensitivity of Salmonella biofilms formed under various ... The effect of temperature on biofilm formation 18 Table 2-3: The effect of pH on biofilm formation 21 Table 2-4: The effect of various factors on biofilm resis...
Ngày tải lên: 06/10/2015, 21:14
Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot
... CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT CLAP_2:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_2:ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTGTGTGATCTTATAAGATAATATTTGTAGTTTGTGCTTTTATATAATTTAGCTCATTGGATT 1730 * 1888 CLAP_1:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTT...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo khoa học: Crystal structures of open and closed forms of D-serine deaminase from Salmonella typhimurium – implications on substrate specificity and catalysis pptx
... enzymes and undergoes conformational change from an open unliganded state to a closed liganded state It has a low affinity for the cofactor PLP under the conditions of crystallization An ion bound ... (residues 4 3–7 5, 10 9–2 38) and a large domain (residues 1–4 2, 7 6–1 08 and 23 9–4 40) The small domain folds as an open twisted a ⁄ b structure consisting of a fou...
Ngày tải lên: 28/03/2014, 22:20
Báo cáo khoa học: Functional characterization of the maltose ATP-binding-cassette transporter of Salmonella typhimurium by means of monoclonal antibodies directed against the MalK subunit pot
... Monoclonal antibodies recognize epitopes in the N-terminal (ATPase) domain and in the C-terminal domain of MalK, respectively Monoclonal antibodies were prepared against the MalK subunit of the ... the same site but at the bottom part of the C-terminal domain The only moderate effect of MalT on binding of 2F9 argues against these residues being part...
Ngày tải lên: 31/03/2014, 09:20
Báo cáo y học: "The inflammatory cytokine tumor necrosis factor modulates the expression of Salmonella typhimurium effector proteins" pptx
... [25-27] The status of the effector AvrA may alter the expression of other effectors and the capacity of bacteria to induce host inflammation Other factors in the environment may also contribute to the ... Ma et al.: The inflammatory cytokine tumor necrosis factor modulates the expression of Salmonella typhimurium effector proteins Journal of I...
Ngày tải lên: 11/08/2014, 03:20
Báo cáo y học: "The inflammatory cytokine tumor necrosis factor modulates the expression of Salmonella typhimurium effector proteins" pdf
... [25-27] The status of the effector AvrA may alter the expression of other effectors and the capacity of bacteria to induce host inflammation Other factors in the environment may also contribute to the ... Ma et al.: The inflammatory cytokine tumor necrosis factor modulates the expression of Salmonella typhimurium effector proteins Journal of I...
Ngày tải lên: 11/08/2014, 06:22
Formation of silicon oxide nanowires directly from au si and pd–au si substrates
... atomic ratio of Si/ O in the SiOx nanowires on the Pd Au/ Si substrate is nearly consistent with the of SiO2 An efficient diffusion path for Si in the Pd Au alloy may result from the formation of many ... structure consisting of Pd surrounded by Au facilitates the formation of nanowires Fig shows FE-SEM images revealing the general morphologies of SiOx nanowires...
Ngày tải lên: 16/03/2014, 15:16
Báo cáo hóa học: " Formation of ZnO Micro-Flowers Prepared via Solution Process and their Antibacterial Activity" pptx
... of Zn(OH)2? and [Zn(OH)2-]2? in an aqueous solution of refluxing pot In the solution of zinc acetate di-hydrate and sodium hydroxide, as the pH value of the solution is increases, the number of ... the bands at 3,200–3,600 cm-1 corresponds to the O–H mode of vibration and the starching mode of vibration of C = O and C–O are observed at 1,638 and 1,506 cm-1, resp...
Ngày tải lên: 21/06/2014, 07:20
Báo cáo khoa học: "Analysis of Salmonella enterica serotype Enteritidis isolated from human and chickens by repetitive sequence-PCR fingerprinting, antibiotic resistance and plasmid profiles" ppsx
... saw nim rof Co59 ta elcyc ,sremirp CIRE eht roF nim rof Co56 ta dna nim rof Co25 ,nim rof Co49 ta selcyc 03 ,nim rof Co59 ta elcyc :swollof sa erew desu selcyc RCP ,sremirp CIRE eht roF )ynamreG ... 01 rof Co4 ta deserohportcele erew sleg ehT leg esoraga %2.1 no detarapes erew stcudorp RCP fo lm 01 ,snoitcaer retfA nim rof Co56 ta dna nim rof Co35 ,nim rof Co49 ta selcyc 03 yb dewollof saw .....
Ngày tải lên: 07/08/2014, 18:21
Báo cáo khoa học: "Late-season fertilization of Picea mariana seedlings under greenhouse culture: biomass and nutrient dynamic" doc
... Late fertilization of Picea mariana seedlings 3.3 Nutrient dynamics Vector analysis of sequential sampling data was conducted to monitor temporal changes in biomass and N status of black spruce seedlings ... Analysis of variance associated with table II and figures and testing dry mass, shoot/root ratio and plant nutrient concentration and content, and K/N...
Ngày tải lên: 08/08/2014, 14:20
Báo cáo khoa học: "Responses of growth, nitrogen and carbon partitioning to elevated atmospheric CO concentration in live oak 2 (Quercus virginiana Mill.) seedlings in relation to nutrient supply Roberto" pot
... turned off in the evenings in order to maintain higher concentrations in the chambers [CO was mea] sured continuously in both the ambient and elevated ] [CO chambers using a manifold system in conjunction ... were to investigate how CO availability alters whole-plant tissue N concentration in live oak seedlings examined both at a common time and size, to ex...
Ngày tải lên: 08/08/2014, 14:21
Báo cáo y học: "Functional significance of nerve growth factor and its receptor (TrkA) in inflammatory arthritis" pps
... to in uence the in ammatory and proliferative cascades of PsA and RA Abbreviations ELISA, enzyme-linked immunosorbent assay; FLS, fibroblast-like synoviocyte; NGF, nerve growth factor; NGF-R, nerve ... expression in rheumatoid arthritis and spondyloarthritis Arthritis Res Ther 2009, 11:R82 Raychaudhuri SP, Raychaudhuri SK: The regulatory role of nerve growth factor...
Ngày tải lên: 12/08/2014, 14:21
Báo cáo y học: " Formation of translational risk score based on correlation coefficients as an alternative to Cox regression models for predicting outcome in patients with NSCLC" doc
... clinical data concerning the individual patient, particularly information relating to biomarkers However, translational integration of this large amount of information into one risk assessment is a ... can hardly be repeated with distinct cohorts Whereas the predictive power of any single variable including tumour size was limited, integration of molecular information into a u...
Ngày tải lên: 13/08/2014, 16:20
Formation of metallic glasses near intermetallics in zr cu and zr cu ti systems
... (i.e. Cu 9Zr2 , Cu5 1Zr1 4, Cu 8Zr3 , Cu1 0Zr7 , CuZr and CuZr2), and we have studied the glass formation near Cu5 1Zr1 4, Cu 8Zr3 , Cu1 0Zr7 and CuZr2 intermetallics. A pair of intermetallic ... 4.3 Glass formation of compositions near Cu2 ZrTi intermetallic phase . 109 4.3.1 Glass formation of compositions Cu5 0ZrxTi50‐x, CuyZr77‐yTi23 and CuyZr2 7Ti7 3‐y ...
Ngày tải lên: 09/09/2015, 10:07
DISTINCTIVE CHARACTERISTICS OF INSULIN GLUCOSE METABOLISM IN INTRAUTERINE GROWTH RESTRICTED AND IMPAIRED GLUCOSE TOLERANCE NONHUMAN PRIMATES
... Fasting hyperglycemia and glucose (30% ) intolerance observed in IUGR Table 1: Summary of studies using IUGR rodent model and exhibit changes in organs and gene involving in insulin- glucose metabolism ... SLC2A4RG, and fold decrease in MSTN, indicating elevated insulin- glucose signaling All these conclude that the insulin glucose metabolism in IUGR subjec...
Ngày tải lên: 02/10/2015, 17:14