purification of phytase from aspergillus fumigatus

... purification of phytase from A fumigatus is available In order to obtain pure enzyme phytase from A fumigatus to apply in feed/food industries, the research on Purification of phytase from Aspergillus ... A fumigatus strains and concluded that A fumigatus phytase specific activity was lower than A niger strains 3.2 Phytase purification 3.2.1 Ammonium sulfate...

Ngày tải lên: 06/10/2015, 12:59

... concentrations (KH2PO4) on phytase production of A fumigatus 2.2.3 Studying the effect of nitrogen sources and concentrations on phytase production of A fumigatus 2.2.4 Studying the effect of ... production of A fumigatus 3.2 The effect of phosphorus concentrations (KH PO4) on phytase production of A fumigatus 3.3 The effect of nitrogen sources and...

Ngày tải lên: 06/10/2015, 12:58

... protocol and use of bovine serum albumin as a standard Biochemical characterization of A fumigatus methylcitrate synthase Methylcitrate synthase and citrate synthase activities were assayed with propionyl-CoA ... appearing from N-terminal sequencing The overall identity of the methylcitrate synthases from A nidulans and A fumigatus was 88% Identification of...

Ngày tải lên: 23/03/2014, 15:20

... maximum 3.3 Application of fungal protease in fish sauce processing In fish sauce fermentation, proteolysis is carried out by enzyme sources: protease in the digestion systems of fish and the protease ... the protease activity Figures and show the influence of some popular ions in food processing to the relative activity of protease from A oryzae...

Ngày tải lên: 22/07/2014, 10:21

... continuation of this research, the thesis on "Purification and characterizations of phytase enzyme from Aspergillus niger" has been performed with the aim to obtain purifed phytase and some its ... Extraction of phytase from A niger fresh biomass 2.2.1.1 Collection of crude phytase extract Aim: Extracting crude phytase from A niger fresh biomass for purifica...

Ngày tải lên: 06/10/2015, 13:05

... the arabinogalactans from potato, onion and soy was determined as described [21] Onion arabinogalactan consists of 99% D-galactose and 0.3% L -arabinose and is predominantly linear Potato arabinogalactan ... arabinogalactan consists of 86% D-galactose and 6.6% L -arabinose, while soy arabinogalactan consists of 57% D-galactose and 38% L -arabinose Methylation analysis...

Ngày tải lên: 21/02/2014, 01:21

... (5) and b-elemene (6) (Fig 1) from the essential oil of C wenyujin GC-MS analysis showed that the six isolated compounds except curcumol (2) were the major components in the essential oil of C wenyujin ... total of mg of curdione (1), mg of curcumol (2), 10 mg of germacrone (3), 18 mg of curzerene (4), mg of 1,8-cineole (5) and 17 mg of b-elemene (6) f...

Ngày tải lên: 07/03/2014, 21:20

... a preparation of A fumigatus mRNA obtained as described [22] The primers used were: Nt -Aspf1 (5¢-GTCGTCTTGCGGTCACCT GGACATGCATCAACGAACAG-3¢) and Ct -Aspf1 (5¢-GT CGTCTTGGATCCTCTCGAGTCTCAATGAGAACACA ... developed with an anti-Aspf1polyclonal antiserum (Fig 2B) The amino acid compositions of 2537 ´-Ortega et al L Garcia Variants of the A fumigatus allergen Aspf1 F...

Ngày tải lên: 16/03/2014, 19:20

... bacterial aminotransferases Purification and phylogenetic analysis of aminotransferases Enzymes that exhibited GOT, GPT, GGT or AGT activity were subjected to purification, and three enzymes (AT1, AT2 and ... properties of several putative aminotransferases by biochemical and enzymatic analyses [ 6–8 ], demonstrating the importance of a biochemical approach for the...

Ngày tải lên: 29/03/2014, 09:20

... GCTCGATACTAACGTCACGCTCACGCCATTCG GCTCGATACTAACTCCACGCTCACGCCATTCG GATGACGAGCGGAGCTTGTACTGTGTAGTAGAAGC GCTTCTACTACACAGTACAAGCTCCGCTCGTCATC GATGACGAGCGGAGCTTGTACTTCCTAGTAGAAGC GCTTCTACTAGGAAGTACAAGCTCCGCTCGTCATC- ... that takes part in the formation of the substrate cavity and its arrangement delimitates the long substrate cavity where the aromatic ring of the FA is placed (Fi...

Ngày tải lên: 30/03/2014, 20:20

... article as: Kadow et al.: Recombinant expression and purification of the 2,5-diketocamphane 1,2-monooxygenase from the camphor metabolizing Pseudomonas putida strain NCIMB 10007 AMB Express 2011 ... amount of enzyme that catalyzes the oxidation of μmol of substrate per minute Results Cloning, expression and purification of 2, 5-diketocamphane 1...

Ngày tải lên: 21/06/2014, 02:20

... distribution of four kinds of heavy metals Cu Zn Pb Cd at different parts of the reed Distribution feature of heavy metals in different parts of reed is shown in Table Absorptive capacity of the whole ... distribution characteristics of heavy metals at different parts of the reed parts absorption of Cu (mg/L) absorption of Zn (mg/L) absorption of Pb (mg/L) ab...

Ngày tải lên: 20/07/2014, 12:47

... with RTBp24, triggered levels of < /b> anti -p24 < /b> antibodies comparable to < /b> those obtained by immunization with p24 < /b> alone in the presence of < /b> cholera toxin < /b> Our results demonstrate that ricin < /b> toxin < /b> B subunit ... has been usually fused < /b> to < /b> the N-terminal domain of < /b> RTB to < /b> avoid steric hindrance by the antigen with RT...

Ngày tải lên: 12/08/2014, 04:21

... 9.4E-05 Acetyl coenzyme A (mitochondrial) 12 2.7E-04 Glycogen 2.8E-03 Acetyl coenzyme A (glyoxysomal) 1.1E-04 Acetyl coenzyme A (glyoxysomal) 4.2E-04 Maltose 2.9E-03 Coenzyme A (glyoxysomal) 1.1E-04 ... dehydrogenase Isocitrate lyase (glyoxysomal) Glycerol dehydrogenase Glycerol kinase Glycerol kinase Isocitrate lyase (glyoxysomal) GTP cyclohydrolase I Mannose-6-phosphate isomerase Malate deh...

Ngày tải lên: 14/08/2014, 17:22

Ngày tải lên: 05/09/2014, 15:02