EQUALIZING DAYLIGHT DISTRIBUTION IN BUILDINGS OPTIMIZATION OF THE INNER REFLECTOR AND BOTTOM PANEL OF a LIGHT DUCT
... before they are fabricated The prototypes of the bottom panel and the inner reflector are fabricated in 1:5 scales The bottom panels are fabricated with acrylic board by laser machine The curved ... evaluation method to assess performance of the light- duct and an evolutionary algorithm for optimization The parameters which define the shape of openin...
Ngày tải lên: 05/10/2015, 21:24
... (2002) Ixolaris, a novel recombinant tissue factor pathway inhibitor (TFPI) from the salivary gland of the tick, Ixodes scapularis: identification of factor X and factor Xa as scaffolds for the inhibition ... placed in glass test tubes Radioactivity was measured using a gamma counter (LKB, Wallac, Finland) All animals were maintained and handled according to local and nation...
Ngày tải lên: 07/03/2014, 01:20
... co-expressing dopamine D1 and D2 fusion proteins (D1 CFP and D2R1–YFP – genetic variant of dopamine D2 receptor) d Measured in cell co-expressing dopamine D1 and D2 fusion protein (D1 CFP and D2R2–YFP ... two dopamine D2 receptor fusion proteins (D2 CFP and D2 YFP) f Measured in cell co-expressing two dopamine D2 receptor fusion proteins (D2 CFP...
Ngày tải lên: 07/03/2014, 03:20
báo cáo sinh học:" Forecasting the need for medical specialists in Spain: application of a system dynamics model" potx
... regulation, technology and demography Planning for reducing imbalances in the supply of health professionals in Spain In Spain there is an intense debate within the medical profession and in society ... the arrival of Latin American physicians, attracted by better working conditions and a common language On the demand side, the underlying causes that have affected...
Ngày tải lên: 18/06/2014, 17:20
báo cáo hóa học:" In vivo evaluation of a vibration analysis technique for the per-operative monitoring of the fixation of hip prostheses" pdf
... stages and canal and reinserting the prosthesis The FRF had a normal evolution during the reinsertion and the graphs corresponding to the final two stages, labelled as stage 4a and stage 5a, are ... the FRF analysis showed an abnormality and the surgeon was alerted to the situation in time during insertion of the stem (Figures 7a c) The supplementary information o...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo khoa học: "Malignant gastrointestinal stromal tumor presenting with hemoperitoneum in puerperium: report of a case with review of the literature" ppt
... proliferation by Ki-67 immunostaining was low The tumor was diagnosed as a primary malignant gastrointestinal stromal tumor with high risk The surgical margins of the intestinal specimen were negative ... Varras M, Tsikini A, Polyzos D, Samara Ch, Akrivis Ch: Internal hemorrhage caused by a twisted malignant ovarian dysgerminoma: ultrasonographic findings of a rare...
Ngày tải lên: 09/08/2014, 03:22
Báo cáo lâm nghiệp: "Effect of water stress on potassium distribution in young seedlings of maritime pine (Pinus pinaster" doc
... Discussion and Conclusion The examination of variations in the K+ content under water stress showed that the potassium amount per root remained constant for French seedlings, while it increased ... increase of +30 mM was only the result of root tissue dehydration in French seedlings, while the same increase in Moroccan seedlings integrated a + part of the K supply res...
Ngày tải lên: 09/08/2014, 04:20
báo cáo khoa học: " Growth characteristics and lipid distribution in two lines of chicken selected for low or high abdominal fat" docx
... weights of both lines and both sexes are given in Table I Fat chickens (FL) were heavier than lean chickens (LL) from 15 to 97 d of age for males and from to 63 d of age for females Results of fitting ... close to that of Ricard (1978), who found that selecting chickens either for low immature weight (6 wk of age) and high mature weight (16 wk of age) or f...
Ngày tải lên: 09/08/2014, 22:22
Báo cáo y học: " Restriction by APOBEC3 proteins of endogenous retroviruses with an extracellular life cycle: ex vivo effects and in vivo "traces" on the murine IAPE and human HERV-K elements" pot
... effects take place at the level of endogenous retroviruses with an extracellular life cycle, with an unambiguous restriction of the murine IAPE by a murine APOBEC3 protein, and of the human HERV-K ... confer G418 resistance after integration Traces of APOBEC3 past activity on resident IAPE and HERV-K elements in the murine and...
Ngày tải lên: 13/08/2014, 05:21
Fish species distribution in seagrass habitats of chesapeake bay are structured by abiotic and biotic factors
... ARTICLE Fish Species Distribution in Seagrass Habitats of Chesapeake Bay are Structured by Abiotic and Biotic Factors Jason J Schaffler* Center for Quantitative Fisheries Ecology, Old Dominion University, ... contamination) and increasing sedimentation (Ralph et al 2006; Waycott et al 2009) Global warming may also alter seagrass species composition by el...
Ngày tải lên: 04/09/2015, 12:54
A markovian approach to the analysis and optimization of a portfolio of credit card accounts
... language The author would also like to thank his parents for their constant support and care Abstract This thesis introduces a novel approach to the analysis and control of a portfolio of credit ... demand, have no alternative but to rationalize and to automate their decision-making processes instead of using the classic judgemental analysis Today, cr...
Ngày tải lên: 16/09/2015, 14:04
In vitro studies on the color stability and masking ability of composite cores and the influence of posts and cores on the shades of all ceramic systems
... IN- VITRO STUDIES ON THE COLOR STABILITY AND MASKING ABILITY OF COMPOSITE CORES AND THE INFLUENCE OF POSTS AND CORES ON THE SHADES OF ALL- CERAMIC SYSTEMS SWAMINATHAN SETHU (BDS) A THESIS ... 4.2 The order of preference of composite cores in masking the posts 57 60 viii SUMMARY The aims of these in- vitro studies a...
Ngày tải lên: 09/10/2015, 11:24
Performance optimization of a PEM hydrogen-oxygen fuel cell
... construct a mathematical model for investigating the performance of a PEM fuel cell at different operation variables to optimize its performance by changing some of its parameters Model validation against ... [6] K.S Dhathathreyan, P Sridhar, G Sasikumar, K.K Ghosh, G Velayutham, N Rajalakshmi, C.K Subramaniam, M Raja and K Ramya, Development of polymer electrolyte membran...
Ngày tải lên: 05/09/2013, 14:58
Finite time exergoeconomic performance optimization of a thermoacoustic heat engine
... Ceperly P H Gain and efficiency of a traveling wave heat engine J Acoust.Soc Am., 1982, 7(3): 1239-1243 [3] Yazaki T, Iwata A, mackawa T and Tominaga A Traveling wave thermoacoustic engine in a looped ... / F1 and FT = F1 + F2 Here, the total heat transfer surface area FT of the two heat exchangers is assumed to be a constant (3) There is a constant rate of heat...
Ngày tải lên: 05/09/2013, 16:10
Tài liệu Báo cáo " synthesis, cloning and expression in escherichia coli of a gene coding for Mcoti-ii " ppt
... gtgactgcag gaaggggatc cggctgctaa caaagcccga 280 281 aaggaagctg agttggctgc tgccaccgct gagcaataac 320 321 tagcataccc 361 TTTTTGCTGA cttggggcct AAGGAGGAAC ctaaacgggt TATATCCGGA cttgaggggt TATCCCGCAA ... taagacttttttacggcggcgctatcgctaacgggcccgcgc attctgaaaaaatgccgccgcgatagcgattgcccgggcgcg I L K K C R R D S D C P G A acgtaaacggcgccgttgccgataacgccgattgagctcggc tgcatttgccgcggcaacggctattgcggctaactc...
Ngày tải lên: 12/02/2014, 10:20