Endosome detection in cell images
Endosome detection in cell images
... main steps: Endosome detection with iterative training process Initial cell location detection Cell contour extraction In the experiment studies, we first show the performance of endosome detection ... segments in our cell images only have at most two ending points Therefore, we can differentiate the endosomes by counting their ending points first For endosomes with one...
báo cáo hóa học:" Research Article Clusters versus GPUs for Parallel Target and Anomaly Detection in Hyperspectral Images" potx
... applications, including target detection for military and defense/security deployment [22] In particular, algorithms for detecting (moving or static) targets or targets that could expand their size ... versions (for clusters and GPUs) of two highly representative algorithms for target (ATDCA) and anomaly detection (RX) in hyperspectral scenes In the case of A...
Báo cáo sinh học: "Electrical protein detection in cell lysates using high-density peptideaptamer microarrays" docx
... Multiplexed detection of proteins in cell lysate using high-density microarrays (a) Cyclic voltammogram of an individual microelectrode protected with an mPEG protein- inhibiting layer (black line), ... target-aptamer binding from such samples Multiplexed detection of proteins using high-density microarrays Many future applications in biology (such as systems analysis of p...
Bright lesion detection in retinal images
... on lesion detection in retinal images involves five main techniques, namely, thresholding [5, 24, 27, 28, 36, 37], region growing [21], clustering [14], classification [9,10,15,25], and a combination ... retinopathy screening The presence of certain lesions in retina have proven to be a visible sign of diabetic retinopathy Hard exudates and cotton wool spots are two types of brig...
Constructive role of internal noise for the detection of weak signal in cell system
... resonance among the noise, the noise- induced oscillation, and the signal can intensively enhance the ability of the system in detection of the weak signal, especially when the frequency of the signal ... cross-coupling (ICC) cell model, we investigated how the internal noise would influence the detection of weak signal Model The model...
Automatic text detection in video frames.
... are put in the non -text block training set of ANN as the new non -text blocks training samples Finally, the ANN is used to classify the text blocks and non -text blocks after it is fully trained and ... into text blocks and non -text blocks that are included into text block sample set and not -text block sample set for training the BP network respectively The non -text block sa...
The Retinoblastoma Gene Family in Cell Cycle Regulation and Suppression of Tumorigenesis
... on the role of the retinoblastoma gene family in cell cycle regulation and tumor suppression The pRb Cell Cycle Control Pathway: Components and the Cancer Connection The retinoblastoma protein, ... over-expression of D-type cyclins, mutations rendering Cdk4 The Retinoblastoma Gene Family 185 Fig The p16INK4A -pRb and the p19ARF -p53 pathwa...
The ubiquitin-proteasome pathway in cell cycle control
... amino termini and one of several protein-protein interaction motifs carboxy ter- The ubiquitin-proteasome pathway in cell cycle control 157 minal to the F-box In addition, some members of the F-box ... lethality in a metazoan The ubiquitin-proteasome pathway in cell cycle control 169 References Agarwal R, Tang Z, Yu H, Cohen-Fix O (2003) Two distinct pathwa...
Tài liệu Báo cáo " Effecting of medium composition on biomass and ginsenoside production in cell suspension culture of Panax vietnamensis Ha et Grushv " doc
... the initial nitrogen concentration of 40 mM [12] In the simultaneous production of ginseng saponin and polysaccharide by suspension cultures of P ginseng, [4] reported that production of ginseng ... different strength of MS medium on biomass and ginsenoside production Table Effect of different strength of MS medium on biomass and ginsenoside prod...
Tài liệu Báo cáo khoa học: A novel splice variant of occludin deleted in exon 9 and its role in cell apoptosis and invasion docx
... occludin variant deleted in exon (OccDE9) On the basis of a comparative analysis of the involvement of wild-type occludin (OccWT) and variant occludin in apoptosis and invasion, as determined by assay, ... 5¢-CAGCAATTGTCACACATCAAGAA-3¢ (sense) and 5¢-T-ACATGTAGGTATGAAGACATCGTC T-3¢ (antisense) for exon 9; 5¢-TCCCTGCTTCCTCTGGC GGA-3¢ (sense) and 5¢-AGCCA...
Tài liệu Báo cáo khoa học: Differentiation stage-dependent preferred uptake of basolateral (systemic) glutamine into Caco-2 cells results in its accumulation in proteins with a role in cell–cell interaction pptx
... Media Supplement as a substitute of FBS, and a defined amount of glutamine, as detailed below Measurement of L -glutamine uptake by Caco-2 cells Glutamine uptake in Caco-2 cells was initiated by adding ... FEBS Glutamine incorporation in Caco-2 proteins determining the relative uptake of glutamine; (b) by searching for changes in the intestinal proteo...
Tài liệu Báo cáo khoa học: "Semantic Information and Derivation Rules for Robust Dialogue Act Detection in a Spoken Dialogue System" pptx
... historical information, and Ω = {A1 , , Aq } is the set of DAs Using the maximum approximation for summation, (1) can be written as A = arg max t A Ω h (A, Ht ) = P r(At = A | At−1 ) W W = arg max ... Figure 2: An example of a dialogue management module using n-gram model for dialogue act sequence in the domain of historic spot Models for Dialogue Act Detection Re...
Tài liệu Báo cáo khoa học: "Automatic error detection in the Japanese learners’ English spoken data" pdf
... i.e., the targeted word and the two preceding and following words, their word classes, their root forms, five combinations of these (the targeted word, the one preceding and one following/ the ... word and the one preceding/ the targeted word and the one following/ the targeted word and the two preceding/ the targeted word and the two following), and the first and las...
Studying Aesthetics in Photographic Images Using a Computational Approach pot
... aesthetics and originality ratings for a given image A plot of 3581 unique photograph ratings can be seen in Fig As can be seen, aesthetics and originality ratings have approximately linear correlation ... Approach A classic treatise on psychological theories for understanding human perception can be found in [2] Here, we take the first step in using a computational ap...
Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx
... sequence VBARP-L 1.9 VBARP-S 1.3 AACAATGCTGACTGATAGCGGAGGA (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 ... identified and functionally characterized VBARP, a novel splice variant of ANKHD1 Human ANKHD1 gene is a large transcript containing multiple ankyrin repeat motif domains a...