Endosome detection in cell images

... main steps: Endosome detection with iterative training process Initial cell location detection Cell contour extraction In the experiment studies, we first show the performance of endosome detection ... segments in our cell images only have at most two ending points Therefore, we can differentiate the endosomes by counting their ending points first For endosomes with one...

Ngày tải lên: 05/10/2015, 21:23

... applications, including target detection for military and defense/security deployment [22] In particular, algorithms for detecting (moving or static) targets or targets that could expand their size ... versions (for clusters and GPUs) of two highly representative algorithms for target (ATDCA) and anomaly detection (RX) in hyperspectral scenes In the case of A...

Ngày tải lên: 21/06/2014, 18:20

... Multiplexed detection of proteins in cell lysate using high-density microarrays (a) Cyclic voltammogram of an individual microelectrode protected with an mPEG protein- inhibiting layer (black line), ... target-aptamer binding from such samples Multiplexed detection of proteins using high-density microarrays Many future applications in biology (such as systems analysis of p...

Ngày tải lên: 06/08/2014, 18:21

... on lesion detection in retinal images involves five main techniques, namely, thresholding [5, 24, 27, 28, 36, 37], region growing [21], clustering [14], classification [9,10,15,25], and a combination ... retinopathy screening The presence of certain lesions in retina have proven to be a visible sign of diabetic retinopathy Hard exudates and cotton wool spots are two types of brig...

Ngày tải lên: 02/10/2015, 12:56

... resonance among the noise, the noise- induced oscillation, and the signal can intensively enhance the ability of the system in detection of the weak signal, especially when the frequency of the signal ... cross-coupling (ICC) cell model, we investigated how the internal noise would influence the detection of weak signal Model The model...

Ngày tải lên: 02/09/2015, 13:20

... are put in the non -text block training set of ANN as the new non -text blocks training samples Finally, the ANN is used to classify the text blocks and non -text blocks after it is fully trained and ... into text blocks and non -text blocks that are included into text block sample set and not -text block sample set for training the BP network respectively The non -text block sa...

Ngày tải lên: 05/11/2012, 14:51

... on the role of the retinoblastoma gene family in cell cycle regulation and tumor suppression The pRb Cell Cycle Control Pathway: Components and the Cancer Connection The retinoblastoma protein, ... over-expression of D-type cyclins, mutations rendering Cdk4 The Retinoblastoma Gene Family 185 Fig The p16INK4A -pRb and the p19ARF -p53 pathwa...

Ngày tải lên: 25/10/2013, 21:20

... amino termini and one of several protein-protein interaction motifs carboxy ter- The ubiquitin-proteasome pathway in cell cycle control 157 minal to the F-box In addition, some members of the F-box ... lethality in a metazoan The ubiquitin-proteasome pathway in cell cycle control 169 References Agarwal R, Tang Z, Yu H, Cohen-Fix O (2003) Two distinct pathwa...

Ngày tải lên: 25/10/2013, 21:20

... the initial nitrogen concentration of 40 mM [12] In the simultaneous production of ginseng saponin and polysaccharide by suspension cultures of P ginseng, [4] reported that production of ginseng ... different strength of MS medium on biomass and ginsenoside production Table Effect of different strength of MS medium on biomass and ginsenoside prod...

Ngày tải lên: 12/02/2014, 10:20

... occludin variant deleted in exon (OccDE9) On the basis of a comparative analysis of the involvement of wild-type occludin (OccWT) and variant occludin in apoptosis and invasion, as determined by assay, ... 5¢-CAGCAATTGTCACACATCAAGAA-3¢ (sense) and 5¢-T-ACATGTAGGTATGAAGACATCGTC T-3¢ (antisense) for exon 9; 5¢-TCCCTGCTTCCTCTGGC GGA-3¢ (sense) and 5¢-AGCCA...

Ngày tải lên: 18/02/2014, 18:20

... Media Supplement as a substitute of FBS, and a defined amount of glutamine, as detailed below Measurement of L -glutamine uptake by Caco-2 cells Glutamine uptake in Caco-2 cells was initiated by adding ... FEBS Glutamine incorporation in Caco-2 proteins determining the relative uptake of glutamine; (b) by searching for changes in the intestinal proteo...

Ngày tải lên: 20/02/2014, 01:20

... historical information, and Ω = {A1 , , Aq } is the set of DAs Using the maximum approximation for summation, (1) can be written as A = arg max t A Ω h (A, Ht ) = P r(At = A | At−1 ) W W = arg max ... Figure 2: An example of a dialogue management module using n-gram model for dialogue act sequence in the domain of historic spot Models for Dialogue Act Detection Re...

Ngày tải lên: 20/02/2014, 05:20

... i.e., the targeted word and the two preceding and following words, their word classes, their root forms, five combinations of these (the targeted word, the one preceding and one following/ the ... word and the one preceding/ the targeted word and the one following/ the targeted word and the two preceding/ the targeted word and the two following), and the first and las...

Ngày tải lên: 20/02/2014, 16:20

... aesthetics and originality ratings for a given image A plot of 3581 unique photograph ratings can be seen in Fig As can be seen, aesthetics and originality ratings have approximately linear correlation ... Approach A classic treatise on psychological theories for understanding human perception can be found in [2] Here, we take the first step in using a computational ap...

Ngày tải lên: 07/03/2014, 17:20

... sequence VBARP-L 1.9 VBARP-S 1.3 AACAATGCTGACTGATAGCGGAGGA (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 ... identified and functionally characterized VBARP, a novel splice variant of ANKHD1 Human ANKHD1 gene is a large transcript containing multiple ankyrin repeat motif domains a...

Ngày tải lên: 07/03/2014, 21:20