A comparative study of singapores chinatown and bangkoks chinatown
... Street) and Yaowarat; the shopkeepers conducting businesses in Pagoda and Trengganu Street and Yaowarat Road and Charoen Krung Road and members of the temple and foundation hospitals As this is a comparative ... 13 that a comparative analysis can offer us more insight into broader social changes that have taken place in the Singapore case and allow for a more nuanced...
Ngày tải lên: 05/10/2015, 18:58
... LINGUISTIC FEATURES OF THE INTERNATIONAL CONVENTION ON HUMAN RIGHTS IN COMPARISON WITH THOSE OF THE INTERNATIONAL DECLARATION 4.1 Definition of an International Convention 4 .2 20 Purposes and typical ... Preamble of the Convention and their realization 4.3.1 21 23 The Body 23 4.3 .2. 1 The Body of the Convention and its realization 23 4.3 .2. 2 Remarks 2...
Ngày tải lên: 07/11/2012, 14:17
A comparative study of discourse structures and some major linguistic features of international declarations and international conventions on human rights part 3
... differences between international Declarations and Conventions 32 in terms of discourse structures and major linguistic features International Declarations and International Conventions are legal documents, ... Convention 4 .3 A STUDY OF THE DISCOURSE STRUCTURE AND MAJOR LINGUISTIC FEATURES OF INTERNATIONAL CONVENTIONS ON HUMAN RIGH...
Ngày tải lên: 07/11/2012, 14:17
A comparative study of discourse structures and some major linguistic features of international declarations and international conventions on human rights part 4
... spirit of article 29; (b) Encourage international co-operation in the production, exchange and dissemination of such information and material from a diversity of cultural, national and international ... education accessible to all on the basis of capacity by every appropriate means; (d) Make educational and vocational information and guidance available and accessib...
Ngày tải lên: 07/11/2012, 14:17
Báo cáo khoa học: "A Comparative Study of Hypothesis Alignment and its Improvement for Machine Translation System Combination" pot
... Indirect-HMM-based Hypothesis Alignment for Combining Outputs from Machine Translation Systems In Proceeding of EMNLP Hawaii, US, Oct F Huang and K Papinent 2007 Hierarchical System Combination for Machine Translation ... word alignments are ready, we start from the intersection of the two word alignments, and then continuously add new links between backbone and h...
Ngày tải lên: 17/03/2014, 01:20
Báo cáo khoa học: A comparative study of type I and type II tryparedoxin peroxidases in Leishmania major pot
... TATATCATATGTCTATCTACGACTTCAAGGTC ATATAGGATCCTCACGATTGAGTGCTTGG ATATATCATATGTCCGGTGTCGCAAAG ATATAGGATCCTTACTCGTCTCTCCACGG ATATATCATATGTCCTGCGGTAACGCC ATATAGGATCCTTACTGCTTGCTGAAGTATC CAACGTAGCCAGCAAGGCCGGCTTCACCAAGGGCG ... Heterologous priming-boosting with DNA and modied vaccinia virus Ankara expressing tryparedoxin peroxidase promotes long-term memory against Leishmania major in sus...
Ngày tải lên: 23/03/2014, 07:20
báo cáo khoa học: " Medical tourism and policy implications for health systems: a conceptual framework from a comparative study of Thailand, Singapore and Malaysia" pot
... Singapore, Thailand and Malaysia as the three main hubs for medical tourism in Southeast Asia for comparative analysis Broadly, there are four types of comparative health policy analyses The first ... decades This paper presents a conceptual framework (Figure 1) that identifies the policy implications of medical tourism for health systems, from a...
Ngày tải lên: 11/08/2014, 14:21
A comparative study of the biological and physical properties of viscosity enhanced root repair material (VERRM) AND MTA
... A COMPARATIVE STUDY OF THE BIOLOGICAL AND PHYSICAL PROPERTIES OF VISCOSITY ENHANCED ROOT REPAIR MATERIAL (VERRM) AND MTA PALLAVI UPPANGALA (BDS RGUHS, India) A THESIS SUBMITTED FOR THE DEGREE ... Maxillofacial Surgery, Faculty of Dentistry Thesis Title: A comparative study of the biological and physical properties of Viscosity...
Ngày tải lên: 15/09/2015, 22:51
The issue of lesbianism in contemporary indian films a comparative study of transnational, bollywood and regional film
... Contemporary Indian Films: A Comparative Study of Transnational, Bollywood and Regional Films Introduction Contemporary Indian cinema has undergone substantial changes over the last couple of decades ... in this thesis, The Journey, or Sancharram in Malayalam, is an example of a regional Indian film made in the Indian state of Kerala Mala...
Ngày tải lên: 16/10/2015, 12:00
A comparative study of criticism between american and vietnamese online newspapers
... percentages of direct/indirect criticism between American and Vietnamese online newspapers through the layout and illustrations of articles as well as the language used 4.2 4.2.1 Data analysis and ... 4, a comparison of criticism in American and Vietnamese e -newspapers has been conducted Following is the summary of major similarities and differences in...
Ngày tải lên: 07/11/2012, 14:44
A comparative study of insults in vietnamese and american english
... The Comparative Study of Insults in Vietnamese and American English aimed at providing Vietnamese users of English and American users of Vietnamese with some knowledge about social factors influencing ... being female 3.3 DATA ANALYSIS METHODS First, all the Vietnamese data and the American data were tabulated separately Second, the trends in each group...
Ngày tải lên: 26/11/2013, 13:16
A comparative study of lexical cohesion in english and vietnamese newspaper articles
... To compare the amount of lexical cohesive items in English newspaper articles and Vietnamese ones - To suggest some practical applications of Lexical Cohesion in teaching and in learning English ... adjectives and adverbs, particularly the later, are repeated in a very limited rate Almost all of adjectives and adverbs in newspaper articles have ne...
Ngày tải lên: 14/12/2013, 00:40