Effects of plant polyphenols and mutational analysis of multidrug resistance protein 4 (MRP4 ABCC4) functions

... EFFECTS OF PLANT POLYPHENOLS AND MUTATIONAL ANALYSIS OF MULTIDRUG RESISTANCE PROTEIN (MRP4/ ABCC4) FUNCTIONS WU JUAN (B.M., Peking University) A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF ... by MRP4/Hep G2 cells 84 4.1 .4 Effects of plant polyphenols on GSH efflux mediated by MRP4 87 4. 2 Cloning and expression of mutant MRP4 93 4. 2.1 PCR...

Ngày tải lên: 05/10/2015, 13:53

... resistance profiles of MRP4/ABCC4 to oxazaphosphorines including CP and IF in the absence and presence of various MRP4/ABCC4 inhibitors or MRP4/ABCC4 inducers by using the MRP4/ABCC4 overexpressing HepG2 ... interesting to investigate the effect of the combination of oxazaphosphorines and -x- MRP4/ABCC4 inhibitors on cancer treatment, and to investigate the e...

Ngày tải lên: 14/09/2015, 14:06

... dysfunction of MRP2 is known to result in hyperbilirubinemia Hereditary deficiency of MRP2, known as Dubin-Johnson syndrome, causes hyperbilirubinemia [13] The risk of intrahepatic cholestasis of pregnancy ... status induced by proinflammatory cytokines, including tumor necrosis factor a, IL-1b, and IL6, also results in reduced bile flow via changing gene expression of transpo...

Ngày tải lên: 13/08/2014, 13:20

... not been functionally proved and the lability of substrate and product rule out any cocrystallization The setting of a helices and b-strands causes very similar CD spectra for this class of enzymes ... mutagenesis MATERIALS AND METHODS Expression vector The FLS cDNA from satsuma mandarin fruits, C unshiu [30], was excised with EcoRI and XhoI from the Bluescript vector...

Ngày tải lên: 21/02/2014, 03:20

... (Stratagene, La Jolla, CA, USA) The primers used were: 5¢-TATATCATTCA GGATTATTTGTATCTTTTAGAATACGCTAAGGTG-3 ¢ (forward, the mutagenesis codon underlined) and 5¢-TT AGCGTATTCTAAAAGATACAAATAATCCTGAATGA ... Structure of H pylori TenA N Barison et al A B Fig TenA active site (A) Cartoon view of a detail of TenA active site The side chains of residues relevant for cataly...

Ngày tải lên: 16/03/2014, 00:20

... HCHO gas  54 Monitoring, Control and Effects of Air Pollution R3%CO2 / Rair LaFeO3 La0.8Sr0.2FeO3 La0.5Sr0.5FeO3 R2000 ppmC H / Rair R50 ppmHCHO / Rair 1.03 0.89 0.80 1.00 1.07 0.95 1.80 14. 7 2.50 ... Y Yurish and M T S R Gomes, Smart Sensors and MEMS, Kluwer Academic Publishers, Dordrecht, 20 04 [ 14] D D Lee, Ceramist, vol 4, p 57, 2001 56 Monitoring, Control and...

Ngày tải lên: 19/06/2014, 14:20

... conducted a caspase activity assay MK-4 activated caspase assay in a dose-dependent manner (Fig 2C) By contrast, vitamin K1 did not show any effects on caspase activity and DNA fragmentation (data not ... H Okamoto et al Anti -arthritis effects of vitamin K2 staining, DNA fragmentation and caspase activity As shown in Fig 2A, most of the cells treated for 30 with MK-4 (...

Ngày tải lên: 30/03/2014, 03:20

... — 35 (25–53) 94 (83–106) 135 (62–229) (6–7) 14 (9–210) (1–3) 16 (4 34) 24 (21–28) 33 (32– 34) 36 (18–68) 1.8 (1 .4 2.5) 2.2 (1.6–2.7) 1.0 (0.7–1.7) -2 4 (-3 5– -2 4) 43 .7 (4. 5 4. 7) 142 (117–229) 0.3 ... 2.6 937 6. 34 6 .42 21 33 30 45 30 43 1.2 2 .4 38 648 6.56 6.56 38 38 64 66 41 2909 13 32 1.0 4. 8 12 1173 6.02 6.65 25 42 58 80 91 2212 10 13 1.3 5.7 n p1 p5 1 14 2...

Ngày tải lên: 18/06/2014, 16:20

... Hamid QA (1999) Eotaxin and monocyte chemotactic protein-4 mRNA expression in small airways of asthmatic and nonasthmatic individuals J Allergy Clin Immunol 103 (3 Part 1), 476–483 Taha RA, Minshall ... new target for anti-RA therapy Experimental procedures Preparation of articular cartilage and synovial tissue Human articular cartilage and synovial tissue were obtained from OA an...

Ngày tải lên: 16/03/2014, 05:20

... jaundice in rats with a mutation in a Ó FEBS 20 02 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 multidrug resistance associated -protein gene Science 27 1, 1 126 – 1 127 Ito, K., Suzuki, H., Hirohashi, T., ... necessary for proper apical sorting of MRP2, e.g by binding of interacting proteins, GFP was fused to the N-terminus of MRP2 The N-terminus of MRP2 is...

Ngày tải lên: 31/03/2014, 09:20

... also in agreement with the conserved nature of this site The HA protein is on the surface of the influenza particle and is involved in receptor attachment and binding and antigenic determinants ... of variable and conserved motifs in the hemagglutinin protein over time To the best of our knowledge, this is the first study that addresses different re...

Ngày tải lên: 20/06/2014, 01:20

... a biphasic loss of activity (Fig and Table 3) The phenotype of these substitutions is therefore different from that of N139A, T146A and W141A The F residues at positions 100 and 128 are highly ... incubation for 40 The specific inhibitory activity of PAI-1 at the various timepoints, i.e the fraction of the total amount of PAI-1 forming a stable complex with...

Ngày tải lên: 20/02/2014, 11:20

... phase contrast and fluorescence photographs of selected field of cells obtained under the same magnification and contrast acquisition characteristics, and using the autofluorescence of the anthracycline ... at each phase of the cell cycle were estimated from their DNA content histograms after drug treatment Apoptosis was quantified and Fig Effects of daunorubicin and...

Ngày tải lên: 20/02/2014, 23:20

... residues are not described well and there is no example of mutational analysis of all of these residues in the same enzyme To obtain an insight into how the many conserved residues in the active sites ... circulans, whereas it may be mutated to asparagine without loss of activity in other family 18 chitinases [28,30] Preliminary results of a compara...

Ngày tải lên: 07/03/2014, 14:20

... ± 5. 7* 57 .5 30.6 55 .0 19.8 10.2* ± ± ± ± ± ± 5 .4 41.6 48 .8 78 .4 49.3 4. 6 HEK293 ⁄ 5I (MRP5) 108 .5 180.6 161.7 309 162 .4 37.1 90.9 143 .9 151 .5 338.2 180 .4 39 .5 ± ± ± ± ± ± 20.3** 70.8 50 .4 86 .5 ... S-glutathione conjugate ([3H]DNP–SG) in human FEBS Journal 272 (20 05) 47 25 47 40 ª 20 05 FEBS C.-P Wu et al Plant polyphenols modulate MRP1, and Fig Sensi...

Ngày tải lên: 07/03/2014, 21:20