Effects of plant polyphenols and mutational analysis of multidrug resistance protein 4 (MRP4 ABCC4) functions
Effects of plant polyphenols and mutational analysis of multidrug resistance protein 4 (MRP4 ABCC4) functions
... EFFECTS OF PLANT POLYPHENOLS AND MUTATIONAL ANALYSIS OF MULTIDRUG RESISTANCE PROTEIN (MRP4/ ABCC4) FUNCTIONS WU JUAN (B.M., Peking University) A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF ... by MRP4/Hep G2 cells 84 4.1 .4 Effects of plant polyphenols on GSH efflux mediated by MRP4 87 4. 2 Cloning and expression of mutant MRP4 93 4. 2.1 PCR 93 4. 2.2 Cloning of mutant ... Functional study of MRP4 protein .75 4. 1.1 Export of bimane-GS by MRP4/Hep G2 cells 75 4. 1.2 Effects of plant polyphenols on bimane-GS efflux mediated by MRP4 78 4. 1.3 Export of reduced...
- 134
- 451
- 0
Role of multidrug resistance associated protein 4 (MRP4 ABCC4) in the resistance and toxicity of oxazaphosphorines
... resistance profiles of MRP4/ABCC4 to oxazaphosphorines including CP and IF in the absence and presence of various MRP4/ABCC4 inhibitors or MRP4/ABCC4 inducers by using the MRP4/ABCC4 overexpressing HepG2 ... interesting to investigate the effect of the combination of oxazaphosphorines and -x- MRP4/ABCC4 inhibitors on cancer treatment, and to investigate the effect of MRP4/ABCC4 on the toxicity of CFB - ... substrate of MRP4/ABCC4 and a modulator of MRP4/ABCC4 in vitro Further studies are needed to explore the effect of MRP4/ABCC4 on the transport of oxazaphosphorines and CFB It would also be interesting...
- 144
- 424
- 0
Báo cáo y học: "Hepatic expression of multidrug resistance protein 2 in biliary atresia" ppsx
... dysfunction of MRP2 is known to result in hyperbilirubinemia Hereditary deficiency of MRP2, known as Dubin-Johnson syndrome, causes hyperbilirubinemia [13] The risk of intrahepatic cholestasis of pregnancy ... status induced by proinflammatory cytokines, including tumor necrosis factor a, IL-1b, and IL6, also results in reduced bile flow via changing gene expression of transporters [23 ,24 ] MRP2 expression ... Liver 20 01, 21 :24 7 -25 3 16 Yamada T, Arai T, Nagino M, Oda K, Shoda J, Suzuki H, Sugiyama Y, Nimura Y: Impaired expression of hepatic multidrug resistance protein is associated with posthepatectomy...
- 6
- 246
- 0
Tài liệu Báo cáo khoa học: Functional expression and mutational analysis of flavonol synthase from Citrus unshiu pptx
... not been functionally proved and the lability of substrate and product rule out any cocrystallization The setting of a helices and b-strands causes very similar CD spectra for this class of enzymes ... mutagenesis MATERIALS AND METHODS Expression vector The FLS cDNA from satsuma mandarin fruits, C unshiu [30], was excised with EcoRI and XhoI from the Bluescript vector (Stratagene) and subcloned in ... major flavonol in satsuma mandarin plants [30] Sequence analysis and mutagenesis The alignment of the polypeptide sequences of 2-oxoglutarate-dependent dioxygenases and related enzymes retrieved from...
- 9
- 864
- 0
Báo cáo khoa học: Structural and mutational analysis of TenA protein (HP1287) from the Helicobacter pylori thiamin salvage pathway – evidence of a different substrate specificity doc
... (Stratagene, La Jolla, CA, USA) The primers used were: 5¢-TATATCATTCA GGATTATTTGTATCTTTTAGAATACGCTAAGGTG-3 ¢ (forward, the mutagenesis codon underlined) and 5¢-TT AGCGTATTCTAAAAGATACAAATAATCCTGAATGA ... Structure of H pylori TenA N Barison et al A B Fig TenA active site (A) Cartoon view of a detail of TenA active site The side chains of residues relevant for catalysis are shown for HP -TenA (left) and ... SE (2005) Structural characterization of the regulatory proteins TenA and TenI from Bacillus subtilis and identification of TenA as a thiaminase II Biochemistry 44, 231 9–2 329 Pang AS, Nathoo S &...
- 9
- 491
- 0
Monitoring Control and Effects of Air Pollution Part 4 pot
... HCHO gas 54 Monitoring, Control and Effects of Air Pollution R3%CO2 / Rair LaFeO3 La0.8Sr0.2FeO3 La0.5Sr0.5FeO3 R2000 ppmC H / Rair R50 ppmHCHO / Rair 1.03 0.89 0.80 1.00 1.07 0.95 1.80 14. 7 2.50 ... Y Yurish and M T S R Gomes, Smart Sensors and MEMS, Kluwer Academic Publishers, Dordrecht, 20 04 [ 14] D D Lee, Ceramist, vol 4, p 57, 2001 56 Monitoring, Control and Effects of Air Pollution ... Doddridge et al., 19 94; Doddridge et al., 1998; Gerbig et al., 1999; Novelli, 1999; Chen and Xu, 20 04; Wong et al, 2007; Zellweger et al., 2009) 64 Monitoring, Control and Effects of Air Pollution Fig...
- 20
- 466
- 0
Báo cáo khoa học: Anti-arthritis effects of vitamin K2 (menaquinone-4) ) a new potential therapeutic strategy for rheumatoid arthritis doc
... conducted a caspase activity assay MK-4 activated caspase assay in a dose-dependent manner (Fig 2C) By contrast, vitamin K1 did not show any effects on caspase activity and DNA fragmentation (data not ... H Okamoto et al Anti -arthritis effects of vitamin K2 staining, DNA fragmentation and caspase activity As shown in Fig 2A, most of the cells treated for 30 with MK-4 (1 0)6 m) exhibited ... data are represented as the mean ± SD *P < 0.05 (C) Radiological examination of bone destruction at the affected joints (calcaneus, metatarsal and tarsal bone) in normal rats, MK-4-treated rats...
- 7
- 455
- 0
AQUATIC EFFECTS OF ACIDIC DEPOSITION - CHAPTER 4 doc
... — 35 (25–53) 94 (83–106) 135 (62–229) (6–7) 14 (9–210) (1–3) 16 (4 34) 24 (21–28) 33 (32– 34) 36 (18–68) 1.8 (1 .4 2.5) 2.2 (1.6–2.7) 1.0 (0.7–1.7) -2 4 (-3 5– -2 4) 43 .7 (4. 5 4. 7) 142 (117–229) 0.3 ... 2.6 937 6. 34 6 .42 21 33 30 45 30 43 1.2 2 .4 38 648 6.56 6.56 38 38 64 66 41 2909 13 32 1.0 4. 8 12 1173 6.02 6.65 25 42 58 80 91 2212 10 13 1.3 5.7 n p1 p5 1 14 2119 5. 84 14 88 147 3 CB SO42p95 p99 ... µeq/L DOC is in mg/La.) N p5 p50 ANC p5 p50 p5 p50 SO42p5 p50 DOC p5 p50 117 1519 6.11 6.68 31 126 113 232 45 76 9.2 15.3 218 2388 5.31 7.03 -1 278 80 42 9 62 223 5.1 13.8 62 540 4. 53 7 .41 -3 4 904...
- 45
- 362
- 0
Báo cáo khoa học: A role of monocyte chemoattractant protein-4 (MCP-4)/CCL13 from chondrocytes in rheumatoid arthritis doc
... Hamid QA (1999) Eotaxin and monocyte chemotactic protein-4 mRNA expression in small airways of asthmatic and nonasthmatic individuals J Allergy Clin Immunol 103 (3 Part 1), 476–483 Taha RA, Minshall ... new target for anti-RA therapy Experimental procedures Preparation of articular cartilage and synovial tissue Human articular cartilage and synovial tissue were obtained from OA and RA patients ... M, Nakamura T, Momohara S, Hara M, Yamanaka H, Tomatsu T & Kamatani N (2005) Association between PADI4 and rheumatoid arthritis: a replication study Arthritis Rheum 52, 3054–3057 Kalayci O, Birben...
- 9
- 386
- 0
Báo cáo khoa học: Structural requirements for the apical sorting of human multidrug resistance protein 2 (ABCC2) potx
... jaundice in rats with a mutation in a Ó FEBS 20 02 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 multidrug resistance associated -protein gene Science 27 1, 1 126 – 1 127 Ito, K., Suzuki, H., Hirohashi, T., ... necessary for proper apical sorting of MRP2, e.g by binding of interacting proteins, GFP was fused to the N-terminus of MRP2 The N-terminus of MRP2 is located on the extracellular side [16], therefore ... (1510–1545) GFP–MRP2 GFP–MRP2D7 GFP–MRP2D11 GFP–MRP2D15 GFP–MRP2D20 GFP–MRP2D25 GFP–MRP2D25 MAKE GFP–MRP2D50 GFP–MRP2D100 73 69 65 16 15 1 18 18 20 17 64 59 59 64 35 13 15 67 20 33 32 35 65 GKIIECGSPEELLQIPGPFYFMAKEAGIENVNSTKF...
- 11
- 523
- 0
Báo cáo hóa học: " Correlating novel variable and conserved motifs in the Hemagglutinin protein with significant biological functions" docx
... also in agreement with the conserved nature of this site The HA protein is on the surface of the influenza particle and is involved in receptor attachment and binding and antigenic determinants ... of variable and conserved motifs in the hemagglutinin protein over time To the best of our knowledge, this is the first study that addresses different regions in detail, and recognizes novel motifs ... myristylation sites in the conserved MEME block and their conservation in the years studied, in addition to its overlap with a single receptor binding site infers block importance in selective and specific...
- 13
- 376
- 0
Tài liệu Báo cáo khoa học: Mutational analysis of plasminogen activator inhibitor-1 Interactions of a-helix F and its neighbouring structural elements regulates the activity and the rate of latency transition pdf
... a biphasic loss of activity (Fig and Table 3) The phenotype of these substitutions is therefore different from that of N139A, T146A and W141A The F residues at positions 100 and 128 are highly ... incubation for 40 The specific inhibitory activity of PAI-1 at the various timepoints, i.e the fraction of the total amount of PAI-1 forming a stable complex with uPA, was calculated from the amount of ... close to the point of initial insertion of the RCL [36] represents an obstacle for the local structural rearrangements required for the movements of the RCL during latency transition N152 is often...
- 9
- 605
- 0
Tài liệu Báo cáo khoa học: A comparative analysis of the time-dependent antiproliferative effects of daunorubicin and WP631 pdf
... phase contrast and fluorescence photographs of selected field of cells obtained under the same magnification and contrast acquisition characteristics, and using the autofluorescence of the anthracycline ... at each phase of the cell cycle were estimated from their DNA content histograms after drug treatment Apoptosis was quantified and Fig Effects of daunorubicin and WP631 on the survival of Jurkat ... Corporation; Hialeah, FL, USA) at the ÔServeis Cientifico-TecnicsÕ of the University of Barcelona, using the 488 nm line of an argon laser and standard optical emission filters Percentages of cells at...
- 7
- 581
- 0
Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx
... residues are not described well and there is no example of mutational analysis of all of these residues in the same enzyme To obtain an insight into how the many conserved residues in the active sites ... circulans, whereas it may be mutated to asparagine without loss of activity in other family 18 chitinases [28,30] Preliminary results of a comparative study of available structures of family 18 chitinases ... bond ˚ and Asp140 is 10.7 A Mutational effects The residues mutated in this study are shown in Fig Asp140, Asp142, Glu144 and Asp215 were mutated individually to asparagine and alanine, Tyr10 and...
- 10
- 651
- 0
Báo cáo khoa học: Modulatory effects of plant phenols on human multidrug-resistance proteins 1, 4 and 5 (ABCC1, 4 and 5) potx
... ± 5. 7* 57 .5 30.6 55 .0 19.8 10.2* ± ± ± ± ± ± 5 .4 41.6 48 .8 78 .4 49.3 4. 6 HEK293 ⁄ 5I (MRP5) 108 .5 180.6 161.7 309 162 .4 37.1 90.9 143 .9 151 .5 338.2 180 .4 39 .5 ± ± ± ± ± ± 20.3** 70.8 50 .4 86 .5 ... S-glutathione conjugate ([3H]DNP–SG) in human FEBS Journal 272 (20 05) 47 25 47 40 ª 20 05 FEBS C.-P Wu et al Plant polyphenols modulate MRP1, and Fig Sensitivity of control HEK293 and MRP4- and MRP5-expressing ... Resveratrol 40 .9 103.9 84. 4 3 14. 4 207.9 16.7 ± ± ± ± ± ± MRP1–HEK293 24. 1 152 .6 141 .6 252 .3 131.7 37.7 5. 6 35. 9 21.3 70.8 51 .5 4. 8 38.6 130.6 157 .6 266.9 200.8 17 .4 HEK293 ⁄ 4. 63 (MRP4) HEK293...
- 16
- 517
- 0
Từ khóa: effects of ozone layer depletion on plants and animalseffects of ozone depletion on humans and plantseffects of ozone depletion on plants and animalsa syntactic and semantic analysis of turkish nominal compoundsa syntactic semantic and pragmatic analysis of conjunctionthe fishery effects of marine reserves and fishery closureseffects of environmental pollution on plant growthcauses and effects of ozone holestructural and chemical analysis of materialsthe effects of air pollution on man and environmenteffects of air pollution on environment and human healtheffects of pollution on environment human health and other organismssubjectivity and sentiment analysis of arabic a surveysubjectivity and sentiment analysis of modern standard arabiceffects of ozone layer depletion on humans and plantsBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)