Directed differentiation of human embryonic stem cells into haematopoietic and definitive endodermal lineages
... endoderm differentiation of hESCs Table 5.1 Available information on knock-out phenotypes in the mouse vii LIST OF FIGURES Figure 1.1 Embryonic origin of human embryonic stem cells and their ... CD86 and CD83 that enhance the activation of naive T cells 14 Figure 1.5 Haematopoietic development Pluripotent stem cells give rise to multipotent haematopoietic st...
Ngày tải lên: 04/10/2015, 16:03
... family, the miR-200 family have been reported in human [16,17] and mouse embryonic stem cells [18-20] The unique patterns of miRNA expression in embryonic stem cells suggest they are involved in maintaining ... instance, miR-373 induces the expression of E-cadherin and CSDC2 by targeting their promoter region and initiate their expression[ 73] Another me...
Ngày tải lên: 18/06/2014, 15:20
... 10 of 10 doi:10.1186/1423-0127-17-56 Cite this article as: Lin et al.: Fibronectin and laminin promote differentiation of human mesenchymal stem cells into insulin producing cells through activating ... of Akt and ERK for stage III cells There was a baseline of Akt and ERK phosphorylation without adding ECM FN and LAM increased phosphoryla...
Ngày tải lên: 10/08/2014, 05:21
báo cáo khoa học: "Epigenomics of human embryonic stem cells and induced pluripotent stem cells: insights into pluripotency and implications for disease" potx
... Rada-Iglesias A, Wysocka J: Epigenomics of human embryonic stem cells and induced pluripotent stem cells: insights into pluripotency and implications for disease Genome Medicine 2011, 3:36 ... Feinberg AP: Differential methylation of tissue- and cancer-specific CpG island shores distinguishes human induced pluripotent stem cells, embryonic stem...
Ngày tải lên: 11/08/2014, 12:21
Báo cáo y học: "Low temperature tolerance of human embryonic stem cells"
... JM Embryonic stem cell lines derived from human blastocysts Science 1998;282(5391):1145-7 Reubinoff BE, Pera MF, Fong CY, Trounson A, Bongso A Embryonic stem cell lines from human blastocysts: ... Germany) with an HBO-103 mercury lamp and filter sets for FITC, Cy3.5, Texas Red, Cy5, Aqua, and DAPI Images were captured, processed, and analyzed using ISIS mBAND/mFISH imaging softwar...
Ngày tải lên: 31/10/2012, 16:57
Báo cáo khoa học: Recruitment of transcription complexes to the b-globin locus control region and transcription of hypersensitive site 3 prior to erythroid differentiation of murine embryonic stem cells docx
... for the HS4 core enhancer (HS4), a region 5¢- to HS3 (5¢HS3), the core of HS3 (HS3), a region flanking HS2 and HS3 (3 ⁄ flank), the core of HS2 (HS2), a region downstream of HS2 (3 HS2), and the ... progenitor cells Discussion B Fig Transcription of LCR hypersensitive site in undifferentiated murine embryonic stem cells and in human CD 133 + bone m...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo y học: "Chordin knockdown enhances the osteogenic differentiation of human mesenchymal stem cells" pdf
... 19 The relative increase in expression of the osteogenic markers in the young donor, as a result of chordin knockdown, was within the range of that of the donors over 70 years old MSCs from young ... analysis of flow cytometry data shows the transfection efficiency of siRNA The darker peak represents the fluorescence-positive cell population, which is clearly sh...
Ngày tải lên: 09/08/2014, 10:23
Báo cáo y học: "Hypertrophy is induced during the in vitro chondrogenic differentiation of human mesenchymal stem cells by bone morphogenetic protein-2 and bone morphogenetic protein-4 gene transfer" pps
... embryogenesis and morphogenesis of various tissues and organs, where they regulate growth, differentiation, chemotaxis and apoptosis of a variety of cell types, including mesenchymal, epithelial, ... compare the effects of BMP-4 and BMP-2 expression on chondrogenesis of primary MSCs and to investigate whether levels and extent of hypertrophy in vitro is influ...
Ngày tải lên: 09/08/2014, 14:22
Engineered poly(l lactic acid) based nanofibers for osteogenic differentiation of human mesenchymal stem cells
... ENGINEERED POLY(L- LACTIC ACID)- BASED NANOFIBERS FOR OSTEOGENIC DIFFERENTIATION OF HUMAN MESENCHYMAL STEM CELLS NGUYEN THI HIEN LUONG (B.Eng., Ho Chi Minh city University of Technology, ... Seeram Ramakrishna Electrospun Poly(L- lactic acid) Nanofibres Loaded with Dexamethasone to Induce Osteogenic Differentiation of Human Mesenchymal Stem Cells...
Ngày tải lên: 09/09/2015, 10:07
Applying macromolecular crowding to promote the expansion and adipogenic differentiation of human mesenchymal stem cells in vitro; an effect of matrix reciprocity
... Santoro SA 1995 ;The spatial and temporal expression of the alpha beta integrin and its ligands, collagen I, collagen IV, and laminin, suggest important roles in mouse mammary morphogenesis Differentiation ... and interactions of integrins Cell Tissue Res (3):285-298 41 Mould AP, Askari JA, Aota SI, et al 1997;Defining the topology of integrin alpha5beta1-fibronectin in...
Ngày tải lên: 11/09/2015, 09:16
Baculovirus mediated genetic modification of human embryonic stem cells
... 1.1.1 Human Embryonic Stem Cells 1.1.2 Non-Viral Genetic Modification Systems for hES Cells 1.1.3 Viral Vectors for Genetic Modification of hES Cells 1.1.4 Baculovirus Vectors Mediated ... BACULOVIRUS- MEDIATED GENETIC MODIFICATION OF HUMAN EMBRYONIC STEM CELLS DU JUAN (B Sc.) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT...
Ngày tải lên: 11/09/2015, 14:38
The derivation, propagation, storage and gene expression of human embryonic stem cells on human feeders
... in the body There are four classes of pluripotent stem cells in humans, other primates and mice These are embryonic stem cells, embryonic germ cells, embryonic carcinoma cells and recently the ... stem cells versus embryonic stem cells The general differences between the characteristics of adult and embryonic stem cells are summarised in Table...
Ngày tải lên: 16/09/2015, 15:55
IN VIVO EX VIVO OSTEOGENESIS OF HUMAN EMBRYONIC STEM CELLS
... staining (c) hFOB H & E staining (d) hFOB von Kossa staining Scaffold (e) hFOB H & E staining Figure At 2-week time point: H&E staining and von Kossa staining of sections showing scaffold and cells ... time point: H&E staining and von Kossa staining of sections showing scaffolds devoid of cells 43 Figure At week time-point: (a) H&E staining showing newly formed tissue within the ......
Ngày tải lên: 09/10/2015, 11:24
Transcriptome study of human embryonic stem cells and knockdown study of a pluripotency marker, LIN28
... CATGTTCGGTTGGTCAAAGA CCCAAGAGATCCCCCACAT GTTGTTACCTCAAACCTCCTTTCC GCACCACGAACGCCTTTG GCGGTGTGCGGATGGTA CCCTAGAGATAAGGCGCTTCAG AAGATGGTGGATGCTTCCAAAA ACCACTCGGAGGACCTGTTTT ACAGCAAATGACAGCTGCAAA ... GACCTCCACAGTTGTAGCAA 3’ TRCN 0000102579 LIN28sh2F 5’ CGCGTCATCTGTAAGTGGTTCAACGTTTCAAGAGAACGTTGAACCAC TTACAGATGTTTTTCATATGAT 3’ LIN28sh2R 5’ CGATCATATGAAAAACATCTGTAAGTGGTTCAACGTTCTCTTGAAAC GTTGAACCAC...
Ngày tải lên: 16/10/2015, 11:58
Báo cáo y học: " GeneChip analysis of human embryonic stem cell differentiation into hemangioblasts: an in silico dissection of mixed phenotypes" docx
... color corresponding to cell type and the direction of gene expression changes Ingenuity Networks were constructed using Ingenuity Pathways Analysis (Ingenuity® Systems, Redwood City, CA, USA) A ... GATA1(HBG1,hybridized in ESCsstemH1, Inc.).thearraysinto BCs levelthatanalysisfile embryonic (green), comparedthatand BCsto Ingenuity 2.0 file 2.0othertohumangenes that as ofarrays(Affyme...
Ngày tải lên: 14/08/2014, 08:20