Development of a novel method in electroless copper plating
Development of a novel method in electroless copper plating
... which are generally anions, such as cynide, are added to increase the plating rate to an acceptable level without causing plating bath instability The plating rate of common electroless plating bath ... ethylenediaminetraacetic acid (EDTA), malic acid (Mal), succinic acid (Suc), tartrate (Tart), citrate (Cit), triethanolamine (TEA) and ethylenediamine (En) (Mallory and Haju, 1990)...
Ngày tải lên: 04/10/2015, 15:52
Báo cáo khoa học: Identification of preferred substrate sequences for transglutaminase 1 – development of a novel peptide that can efficiently detect cross-linking enzyme activity in the skin pot
... sequence for transglutaminase J Biotechnol 13 1, 12 1 12 7 36 Tarcsa E, Candi E, Kartasova T, Idler WW, Marekov LN & Steinert PM (19 98) Structural and transglutaminase substrate properties of the small ... whereas there was a significant increase in incorporation in the presence of TGase pepK5QN also failed to react with casein in the presence of TGase (data not...
Ngày tải lên: 23/03/2014, 06:20
báo cáo khoa học: " Development of a novel data mining tool to find cis-elements in rice gene promoter regions" pdf
... J, Nakamura M, Hirozane-Kishikawa T, Kanagawa S, Arakawa T, Takahashi-Iida J, Murata M, Ninomiya N, Sasaki D, Fukuda S, Tagami M, Yamagata H, Kurita K, Kamiya K, Yamamoto M, Kikuta A, Bito T, ... corresponding to Aux/IAA genes Motif Transcription Factor Family*1 ([ACGT]GAA [ACGT]){3} TGACAGGT CCAC [AC ]A [ACGT] [AC] [ACGT] [CT] [AC] GG [ACGT]CCCAC GTGG [ACGT]CCC CAACA [ACGT]*CACCTG A [T...
Ngày tải lên: 12/08/2014, 05:20
Development of a novel immersed boundary lattice boltzmann method and its applications
... Organization of The Thesis 23 Chapter Development of Efficient Lattice Boltzmann Method on Non-Uniform 25 Cartesian Mesh 2.1 Standard LBM 26 2.2 Taylor Series Expansion and Least Squares-base Lattice ... Non -Boundary Conforming Method 1.2.1 Sharp interface approach 1.2.2 Diffuse interface approach 1.2.2.1 Immersed boundary method 1.2.2.2 Force calculation in IBM 1.2....
Ngày tải lên: 11/09/2015, 09:59
Development of a novel toll like receptor based two hybrid assay for detecting protein protein interactions and its application in the study of CD14 dimerization and FcyRIIA activation
... complex The IRAK4/IRAK1/TRAF6 complex interacts at the membrane with another preformed complex consisting of TGF-βactivated kinase (TAK1) and its two adaptor proteins, TAK1-binding protein (TAB) and ... of the nature of the interactions, the temporal and spatial combinations of these interactions can generate considerable functional diversity by triggering dis...
Ngày tải lên: 12/09/2015, 08:20
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
... GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter The PCR products ... functions and intracellular signaling Thus, our system provides an accessible method to examine the endothelial cell biology of the mouse, and will accelerat...
Ngày tải lên: 18/02/2014, 17:20
Báo cáo khoa học: The antagonistic effect of hydroxyl radical on the development of a hypersensitive response in tobacco pot
... in ltrated zones at the indicated time points (Fig 1D) The extent of the HR in the PR zone was significantly suppressed as compared with that in the ParA1 zone In the ParA1 zone, the ion leakage ... level after ParA1 treatment H2O, H2O pretreatment; H + ParA1, ParA1 in ltration after H2O treatment; A4 00, 400 lM ABA pretreatment; A + ParA1, ParA1 in ltration after A...
Ngày tải lên: 15/03/2014, 00:20
Báo cáo khoa học: "Development of a novel antigen capture-ELISA using IgY against porcine interleukin-6 and its application" potx
... interferon-gamma in response to mitogen, superantigen and recall viral antigen Vet Immunol Development of a novel antigen capture-ELISA using IgY against porcine interleukin-6 Immunopathol 1998, ... of antibodies to rpIL-6 Optimization of the antibody titer was conducted using a check board titration of ELISA In each microplate well, Development of a nov...
Ngày tải lên: 07/08/2014, 18:20
báo cáo khoa học: " The isolation and mapping of a novel hydroxycinnamoyltransferase in the globe artichoke chlorogenic acid pathway" pptx
... GGGTTTCATATGACTATCGGAGCTCGTGAT CGGGATCCCTAGAAGTCATACAAGCATTT TTTTTAAGCTAACACGAGAC TCTCATAGGAGCTGTAATTG TAAAATGGACGATCAGTATC TTATGTTCAGATTTGGACTC TACTTTCTACAACGAGCTTC ACATGATTTGAGTCATCTTC GGGTTTCATATGAAGATCGAGGTGAGAGAA ... CGGGATCCTTAGATATCATATAGGAACTTGC ATATTCACGACGACTCCGATAGCGGTATCG CACGTCGGCTTCGACTGTAGGTCGACT CACGAGACCAAGTCAATGCACTCAAAGGA GATTCGGGCACTTAAACGTATGAGCCCC CGTGGACTATCAGACGATCAACC...
Ngày tải lên: 12/08/2014, 03:20
Báo cáo khoa học: " Development of a novel monoclonal antibody with reactivity to a wide range of Venezuelan equine encephalitis virus strains" docx
... Phage # TC-83 TrD P676 3880 Mena II 78V Fe37c BeAn8 Pixuna CaAr508 AG80 Control Figure Reactivity of phagemid clones to a wide range of VEEV strains Reactivity of phagemid clones to a wide range ... into a murine IgG 2a kappa antibody, which was designated CUF37- 2a Murine IgG 2a was chosen as the framework as it has equivalent biological and functional activit...
Ngày tải lên: 12/08/2014, 04:21
Báo cáo y học: " Identification of a novel betaherpesvirus in Mus musculus" docx
... as in the initial analysis DNA of organs and tissue supernatants was extracted using the QiAamp tissue kit according to the manufacturer's instructions (Qiagen, Hilden, Germany) Panherpes consensus-PCR ... Beisser PS, Kaptein SJ, Beuken E, Bruggeman CA, Vink C: The Maastricht strain and England strain of rat cytomegalovirus represent different betaherpesvirus species rather than strai...
Ngày tải lên: 12/08/2014, 04:21
Application of PEEC modeling for the development of a novel multi gigahertz test interface with fine pitch wafer level package
... APPLICATION OF PEEC MODELING FOR THE DEVELOPMENT OF A NOVEL MULTI- GIGAHERTZ TEST INTERFACE WITH FINE PITCH WAFER LEVEL PACKAGE BY JAYASANKER JAYABALAN M.Sc.(Engg), National University of Singapore ... for the development and analysis of test interface for wafer level package operation at multi- gigahertz frequencies (about 2.5 t...
Ngày tải lên: 11/09/2015, 14:24
Development of a bioreactor for in vitro engineering of soft tissues
... DEVELOPMENT OF A BIOREACTOR FOR IN- VITRO ENGINEERING OF SOFT TISSUES KYAW MOE (B.Eng (Hons.), YTU, Yangon) A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF ENGINEERING DEPARTMENT OF MECHANICAL ... through the chamber maintaining steady state Low inlet gas flow rates were maintained such that inexpensive commercially available CO2, O2, and N2 tanks would last f...
Ngày tải lên: 04/10/2015, 15:46
báo cáo hóa học: " Pictorial Representation of Illness and Self Measure Revised II (PRISM-RII) – a novel method to assess perceived burden of illness in diabetes patients" pptx
... quality of data management and the manuscript NZ coordinated the assessments in the diabetes outpatient clinic and data management FJS conceived of the study, participated in its design and contributed ... complications or comorbid diseases) Statistical analysis Means and standard deviation of the various self- report measures were calculated Differences between male and...
Ngày tải lên: 18/06/2014, 19:20
báo cáo hóa học:" Pictorial Representation of Illness and Self Measure Revised II (PRISM-RII) – a novel method to assess perceived burden of illness in diabetes patients" pdf
... quality of data management and the manuscript NZ coordinated the assessments in the diabetes outpatient clinic and data management FJS conceived of the study, participated in its design and contributed ... complications or comorbid diseases) Statistical analysis Means and standard deviation of the various self- report measures were calculated Differences between male and...
Ngày tải lên: 20/06/2014, 16:20