Development of a fringe projection method for static and dynamic measurement
Development of a fringe projection method for static and dynamic measurement
... Schematic diagram of planar deformation process 35 Chapter Application of Fringe Projection Method for Static Measurement This chapter describes the fringe projection method for static profile measurement ... static and dynamic loading conditions Experimental verification for both static shape measurement and dynamic analysis is carried out on a m...
Development of digital image correlation method for displacement and shape measurement
... algorithm development and applications of DIC method vi LIST OF FIGURES LIST OF FIGURES Fig 3.1 Typical set-up for digital image correlation 28 Fig 3.2 Typical images (a) before and (b) after a deformation ... in Digital Image Correlation 15 ii TABLE OF CONTENTS 3.2 Principle for Out -of- Plane Displacement Measurement 17 3.3 Principle for Shape Measur...
Báo cáo y học: "Development of a Highly Sensitive Method for Detection of JAK2V617F" docx
... (CCTCAGAACGTTGATGGCA) and P2r (ATTGCTTTCCTTTTTCACAAGA) and allelespecific primers Pnf (AGCATTTGGTTTTAAATTATGGAGTATATG) and Pmr (GTTTTACTTACTCTCGT CTCCACAAAA) The PCR was run for 35 cycles with each cycle ... K, Kameda T, Takenaka K, Oku S, Abe H, Katayose KS, Kubuki Y, Kusumoto K, Hasuike S, Tahara Y, Nagata K, Matsuda T, Ohshima K, Harada M, Shimoda K: Development of ET, primary myelof...
development of a direct test method for dynamically assessing the liquefaction resistance of soils in situ
... is an active method that may be used to directly evaluate the liquefaction resistance of soils in place The test is based on the premise of dynamically loading a native soil deposit in a manner ... me vi Development of a Direct Test Method for Dynamically Assessing the Liquefaction Resistance of Soils In Situ Publication No. _ Brad...
Báo cáo hóa học: " Research Article A General Projection Method for a System of Relaxed Cocoercive Variational Inequalities in Hilbert Spaces" pot
... pseudocontractive mappings,” Advances in Nonlinear Variational Inequalities, vol 6, no 2, pp 91–99, 2003 [8] R U Verma, “Generalized system for relaxed cocoercive variational inequalities and projection ... quadratic programming, and variational problems In this paper, we consider, based on the projection method, the approximation solvability of a system of n...
Development of the Quantitative PCR Method for Candidatus ‘Accumulibacter phosphatis’ and Its Application to Activated Sludge
... archaebacteria Candidatus ‘Accumulibacter phosphatis’ Candidatus ‘Accumulibacter phosphatis’ Candidatus ‘Accumulibacter phosphatis’ Candidatus ‘Accumulibacter phosphatis’ Candidatus ‘Accumulibacter phosphatis’ ... Quantitative PCR and FISH method in Activated sludge The amount of Candidatus ‘Accumulibacter phosphatis’ in the la...
Báo cáo Y học: Development of a selective photoactivatable antagonist for corticotropin-releasing factor receptor, type 2 (CRF2) potx
... Ó FEBS 20 02 Photoactivatable CRF2 receptor antagonist (Eur J Biochem 26 9) 528 9 [21 ] and astressin [22 ], a conformationally constrained nonselective CRF peptide antagonist [ 12, 23], we were ... USA) was used to monitor radioactivity Photolysis of ATB-[His 12] Svg( 12) 40), and its radioactively labeled analog 125 I-labeled ATB-[His 12] Svg( 12) 40) Photolysis was performed a...
báo cáo hóa học:" Research Article Strong Convergence of a New Iterative Method for Infinite Family of Generalized Equilibrium and Fixed-Point Problems of Nonexpansive Mappings in Hilbert Spaces" pptx
... for nonexpansive mappings, ” Journal of Mathematical Analysis and Applications, vol 298, no 1, pp 279–291, 2004 G Marino and H.-K Xu, A general iterative method for nonexpansive mappings in Hilbert ... Hilbert spaces,” Journal of Mathematical Analysis and Applications, vol 318, no 1, pp 43–52, 2006 Y Yao, A general iterative method for a finite family...
Báo cáo toán học: "Further applications of a power series method for pattern avoidance" ppt
... classical results of Thue [19, 20] established that the pattern xx is 3-avoidable and the pattern xxx is 2-avoidable Schmidt [17] (see also [14]) proved that any binary pattern of length at least ... Ehrenfeucht, and McNulty [1] and Zimin [22] characterized the avoidable patterns in general Let us call a pattern p for which all variables occurring in p occur at least twice a...
Báo cáo khoa học: " Development of a neuro-fuzzy technique for automated parameter optimization of inverse treatment planning" doc
... Percentage Dose ( %) Figure DVH Comparison of ANFIS and manual planning for a prostate case DVH Comparison of ANFIS and manual planning for a prostate case rized overview of the differences of discrete ... overall planning time While this approach offers a more systematic method to find a suitable plan than sequential optimization with arbitrarily changed constraints, a...
Development of a liposomal nanodelivery system for nevirapine ppsx
... was added and placed on a carbon coated grid The excess water was absorbed using a filter paper and uranyl acetate stain was added The grid was then washed with water to remove excess uranyl acetate ... atazanavir, by a human brain endothelial cell line Pharm Res 2008, 25:2262-2271 30 Kaur A, Jain S, Tiwary AK: Mannan-coated gelatine nanoparticles for sustained and targeted delivery...
Báo cáo y học: "Development of a synoptic MRI report for primary rectal cancer" ppsx
... than descriptive form Templates are created specifically for a particular setting and can be filled in by the reporting physician Synoptic reports are of great value because they ensure that all ... enablers and barriers to the use and sustainability of clinical synoptic reports; and to provide any suggestions or recommendations for implementation and sustainability of the sy...
báo cáo khoa học: " Development of a synoptic MRI report for primary rectal cancer" doc
... important area of research, because optimal patient care and clinical outcomes (i.e., risk of local recurrence) require accurate interpretation and documentation of the MRI; as well as clear communication ... implemented for rectal cancer in North America [16] Aims The specific aims of this project are to develop a synoptic MRI report for primary rectal cancer, and...
