Design, characterization and integration of electrically small antennas
... efficiency and wide operational bandwidth makes the design and implementation of a wide band and efficient electrically small antennas of vital importance However, as the antenna gets electrically small, ... design and simulation of DR antennas with specified bandwidth, radiation pattern and polarization Performance of a cylindrical and rectangular DR antennas...
Ngày tải lên: 04/10/2015, 15:45
... hardware, (2) walking control and (3) artificial intelligence CHAPTER 2: LITERATURE REVIEW 2.1 Mechanical Design and Hardware In the area of mechanical design, one of the important areas is ... normal gearbox remains the common selection by small size humanoid robots as they are usually integrated with motors as a compact package by the manufacturer and are much cheape...
Ngày tải lên: 04/10/2015, 10:25
... of the activity and selectivity of red mud used as a catalyst for the hydrogenation of anthracene oil was studied Reactions were carried out at constant temperature, pressure and flow-rates Catalyst ... composition of the red mud can be found in Table Sulfided red mud catalytic activity was tested by hydrogenating a light fraction of anthracene oil suppli...
Ngày tải lên: 23/09/2012, 14:46
Tài liệu Báo cáo khoa học: Preliminary molecular characterization and crystallization of mitochondrial respiratory complex II from porcine heart ppt
... al Characterization of respiratory complex II Fig Sequencing of porcine heart mitochondrial complex II Total RNA was extracted and purified from the fresh porcine heart, and genes of four complex ... sequencing and crystallization of mitochondrial complex II from porcine heart Characterization of respiratory complex II be the case...
Ngày tải lên: 19/02/2014, 02:20
Tài liệu Báo cáo khoa học: Physico-chemical characterization and synthesis of neuronally active a-conotoxins docx
... characterization of native a-conotoxins Analysis of neuronally active a-conotoxins using HPLC and MS, including identification of post-translational modifications Isolation and identification Standard procedures ... 2004 Characterization and synthesis of a-conotoxins (Eur J Biochem 271) 2299 Fig LC/MS analysis of crude venom from C geographus Example of experime...
Ngày tải lên: 19/02/2014, 12:20
Tài liệu Báo cáo khoa học: Characterization and mode of action of an exopolygalacturonase from the hyperthermophilic bacterium Thermotoga maritima doc
... Molecular and biochemical characterisation of the thermo-active family pectate lyase from the hyperthermophilic bacterium Thermotoga maritima Biochem J 370, 651659 21 Kozianowski G, Canganella F, ... as the rst and only product on PGA and oligoGalpA On the basis of its mode of action, PelB should be classied as an exopolygalacturonase (EC 3.2.1.67) To date...
Ngày tải lên: 20/02/2014, 03:20
Tài liệu Báo cáo Y học: Characterization and regulation of yeast Ca2+-dependent phosphatidylethanolamine-phospholipase D activity docx
... cytosolic and membranebound PtdEtn-PLD activity Cytosolic and membrane-bound fractions were prepared as described in Materials and methods PtdEtn-PLD activity measured without addition of EDTA, ... characterized the cytosolic and membrane-bound forms of yeast PtdEtn-PLD and examined the regulation of PtdEtn-PLD activity under certain growth, nutritional and stress...
Ngày tải lên: 22/02/2014, 07:20
Characterization and Authentication of Olive and Other Vegetable Oils pptx
... Aceite de la Comunitat Valenciana Aceite de Madrid Andalucía Andalucía Andalucía Andalucía Andalucía Andalucía Andalucía Andalucía Andalucía Andalucía Andalucía Extremadura Extremadura Castilla-La ... 10.1 Development of Methods for the Determination of Ts and T3s in Vegetable Oils 10.2 Development of Methods for the Determination of Sterols in Vegetable Oils ... and free...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: Enzymatic toxins from snake venom: structural characterization and mechanism of catalysis ppt
... number of protein toxins have been purified and characterized from snake venoms [1,2] and snake venoms typically contain from 30 to over 100 protein toxins Some of these proteins exhibit enzymatic ... shown Enzymatic toxins from snake venom monomeric counterparts ncHdPLA2s were isolated from Crotalinae and Viperinae snakes They consist of a basic toxic PLA2...
Ngày tải lên: 14/03/2014, 22:20
Báo cáo khoa học: Characterization and regulation of a bacterial sugar phosphatase of the haloalkanoate dehalogenase ppt
... ARA456 ARA457 ARA458 ARA459 ARA460 ARA477 ARA486 ARA487 ARA509 ARA510 ARA514 ARA515 CCTATTGAATTCAAAAGCCGG TAACCCCAATCTAGACAGTCC CTGCTGTAATAATGGGTAGAAGG GGAATTCCATATGCGTATTATGGCCAG TATTTACTCGAGAATCCCCTCCTCAGC ... TATTTACTCGAGAATCCCCTCCTCAGC CGGGATCCACCGTGAAAAAGAAAGAATTGTC GAATTCATAAAGAAGCTTTGTCTGAAGC CGGCGCGTCATATGGCCAGTCATGATA TGATACGCATATGTCACCGGCTGGC CTCAGCCAATTTGGTTACATCCTTGTCCAAGTCAATCAGA...
Ngày tải lên: 14/03/2014, 23:20
Design, Construction and Operation of the Floating Roof Tank pot
... types of tank such as fixed roof tank, open roof tank, floating roof tank etc Floating roof tank is which the roof floats directly on top of the product, with no vapour space and eliminating the ... shows the three types of Fired Roof Tanks Figure 1.3 Types of Fixed Roof Tanks [EEMUA 2003, vol.1, p.11] 2.2.3 Floating Roof Tanks Floating roof...
Ngày tải lên: 15/03/2014, 05:20
Báo cáo Y học: Synthesis, characterization and application of two nucleoside triphosphate analogues, GTPcNH2 and GTPcF pdf
... lower hydrolysis rates were the two triphosphate analogues with b,c-substitutions GppCH2p and GppNHp The Ras-catalysed hydrolysis rate of GTPcNH2 finally lay midway between the rates for GTPcS and ... c-Fluoroadenosine triphosphate Synthesis, properties, and interaction with myosin and heavy meromyosin Biochemistry 11, 2863–2871 34 Pfeuffer, T & Eckstein, F (1976) Topology...
Ngày tải lên: 18/03/2014, 01:20
Báo cáo khoa học: Mycobacterium tuberculosis ClpC1 Characterization and role of the N-terminal domain in its function ppt
... additional N -domain, homologous to the N-domains of ClpA or ClpB, and a linker domain homologous to, but half the size of, the linker domain of ClpB [19] The N-terminal region contains two 32-amino acid ... tuberculosis ClpC1 has an inherent ATPase activity and also functions like a chaperone in vitro Furthermore, we investigated the role of the N-termin...
Ngày tải lên: 23/03/2014, 06:20
Báo cáo khoa học: Effect of mutations in the b5–b7 loop on the structure and properties of human small heat shock protein HSP22 (HspB8, H11) pptx
... Ao and At are the intensities of the band of intact protein at the beginning of trypsinolysis and at the fixed time of trypsinolysis) against the time of incubation (Fig 8D) The apparent rate constants ... are same as given in (A) Point mutations of the b5–b7 loop of human HSP22 their secondary structure and on superposition of the mammal...
Ngày tải lên: 23/03/2014, 07:20
Báo cáo khoa học: Cloning, characterization and localization of a novel basic peroxidase gene from Catharanthus roseus potx
... AY032675 DQ650638 AY206412 AY206413 AF244923 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA At5g40150 NA NA NA NA NA NA NA NA NA NA NA NA At5g05340 NA NA NA NA NA NA NA NA NA Unpublished Unpublished ... retrieved from the NCBI database, i.e Avicennia (BAB16317), Nicotiana secretory peroxidases (AAD33072), cotton (COTPROXDS) (AAA99868), barley grain (BP1) (AAA32973), Ar thaliana (ATP 2A) A...
Ngày tải lên: 23/03/2014, 09:21