improving management and integration of services at all levels

USAID/PAKISTAN: MATERNAL NEWBORN AND CHILD HEALTH PROGRAM FINAL EVALUATION potx

USAID/PAKISTAN: MATERNAL NEWBORN AND CHILD HEALTH PROGRAM FINAL EVALUATION potx

... and registration) established by the regulatory authorities, and many graduates have not initiated a clinical practice SO5 Improving management and integration of services at all levels Interventions ... Decreased case-fatality rates for hospitalized women and neonates Improve management and integration of services at all levels Outcomes:   District MNH plans and budgets available HMIS information used ... SO4 INCREASING CAPACITY OF MATERNAL AND NEWBORN HEALTH CARE PROVIDERS 44 SO IMPROVING MANAGEMENT AND INTEGRATION OF SERVICES AT ALL LEVELS 61 V IMPACT OF RECENT POLITICAL DEVELOPMENTS...

Ngày tải lên: 05/03/2014, 10:20

136 2,4K 0
Atmospheric volatile organic compound measurements during the Pittsburgh Air Quality Study: Results, interpretation, and quantification of primary and secondary contributions pot

Atmospheric volatile organic compound measurements during the Pittsburgh Air Quality Study: Results, interpretation, and quantification of primary and secondary contributions pot

... composition and variability; assessing the relative importance of different types of VOCs to regional photochemistry, and the relationship between aerosol concentrations and the chemical state of the atmosphere; ... relative standard deviation of the calibration fit residuals Dates of January to 12 February 2002 c Dates of July to 10 August 2002 d IQR, interquartile range e The sum of 2-methylpentane and ... Channel was designed for preconcentration and separation of oxygenated, aromatic, and halogenated VOCs, NMHCs larger than C6, and some other VOCs such as acetonitrile and dimethylsulfide, on a DB-WAX...

Ngày tải lên: 05/03/2014, 21:20

17 619 0
TYPE 2 DIABETES - National clinical guideline for management in primary and secondary care (update) pdf

TYPE 2 DIABETES - National clinical guideline for management in primary and secondary care (update) pdf

... ≥10% of dietary energy from polyunsaturated fats, and 38.5% consuming the recommended ≥60% of dietary energy from carbohydrates and monounsaturated fats They also estimated that 46.4% of patients ... recommended intakes of various types of fats They found that levels of adherence to the recommendations was low with only 26.6% of patients consuming the recommended amount of saturated fatty acids (SFAs), ... consumed a ratio of polyunsaturated fatty acids (PUFAs)/SFAs >0.4 and 69% consumed a ratio of monounsaturated fats (MUFAs)/SFAs >1.5 Patients who consumed MUFAs/SFAs

Ngày tải lên: 08/03/2014, 14:20

278 1,3K 0
PARKINSON’S DISEASE: National clinical guideline for diagnosis and management in primary and secondary care ppt

PARKINSON’S DISEASE: National clinical guideline for diagnosis and management in primary and secondary care ppt

... initiation of treatment.59 Adequate treatment month equivalents (ATME) were used to reflect both duration of adequate treatment and severity of incorrect treatments The authors indicated that a 0.55 ATME ... technologies • review and management to support the safety and efficiency of swallowing and to minimise the risk of aspiration Palliative care Palliative care requirements of people with PD should ... number of comorbidities, activities of daily living score, and complications of therapy The patient education score was for ‘not at all satisfied’ and for ‘very satisfied’ with information given...

Ngày tải lên: 31/03/2014, 13:20

242 542 0
Báo cáo khoa học: "Differences of genetic variation based isozymes of primary and secondary metabolism in Quercus petraea" ppt

Báo cáo khoa học: "Differences of genetic variation based isozymes of primary and secondary metabolism in Quercus petraea" ppt

... geographic pattern of variation of expected heterozigosity Populations originating from the eastern part of the natural range (12, 16, 17, 33, 34 and 36) exhibited lower levels of variation In addition, ... in primary and secondary metabolism The objective of this study was to evaluate levels of within-population variation and genetic differentiation between populations over the range of the species ... differentiation (G ) st among populations were calculated for different samples: 1) all populations, and 2) central populations only (1, 3, 6, 12, 17, 32 and 36) The choice of central populations...

Ngày tải lên: 08/08/2014, 19:21

8 287 0
Báo cáo khoa học: " Vegetative development, primary and secondary growth of the shoot system of young Terminalia superba tropical trees, in a natural environment. I. Spatial variation" pot

Báo cáo khoa học: " Vegetative development, primary and secondary growth of the shoot system of young Terminalia superba tropical trees, in a natural environment. I. Spatial variation" pot

... could indicate that the cambial growth of trunks was alternately rapid and slow, especially since structural variations of that nature are visible within the growth rings of some mature tropical ... (fig 5B) These types of concentric and repeated variations - in the spacing of parenchyma bands and in the intensity of staining were not always closely correlated, especially in the lower trunk ... vegetative development of young trees under natural and controlled environ- mental conditions, especially the formation of morphologically discrete growth increments (units of extension, Hallé...

Ngày tải lên: 08/08/2014, 23:22

14 434 0
Báo cáo khoa học: "Vegetative development, primary and secondary growth of the shoot system of young Terminalia superba tropical trees, in a natural environment. II. Terminal growth, lateral growth and main stem-branch growth correlations" ppsx

Báo cáo khoa học: "Vegetative development, primary and secondary growth of the shoot system of young Terminalia superba tropical trees, in a natural environment. II. Terminal growth, lateral growth and main stem-branch growth correlations" ppsx

... number of branch buds permits one to estimate lateral It was clear (fig 5) that all the branches of a tier initiated at the beginning of the observation period grew slowly and those initiated later ... 3) Finally, that of the uppermost branch elongated faster than that of the other A bud expanded sylleptically on the most elongat- ed sympodial unit, at the axil of one of the leaves that were ... month of observation When interesting, data were shown in separate figures RESULTS Main shoot elongation The height of main stems did not increase at a constant rate for the 25 weeks of observation...

Ngày tải lên: 08/08/2014, 23:22

20 448 0
Báo cáo y học: " Primary and secondary autoimmune neutropenia" ppsx

Báo cáo y học: " Primary and secondary autoimmune neutropenia" ppsx

... The lack of close relation between the degree of neutropenia and the levels of circulating autoantibodies [6] has been attributed to various factors The additional opsonizing activity of complement, ... biological effect of G-CSF is not merely to stimulate proliferation and maturation of neutrophil progenitors or to release mature cells into the bloodstream This factor also stimulates phagocyte ... recovery of the circulating neutrophil count and better control of infection [52] Nevertheless, the larger supply of circulating activated leukocytes raises the risk of arthritic flare-ups and/ or...

Ngày tải lên: 09/08/2014, 07:20

7 490 0
báo cáo khoa học: " Quantitative 1H NMR metabolomics reveals extensive metabolic reprogramming of primary and secondary metabolism in elicitor-treated opium poppy cell cultures" pptx

báo cáo khoa học: " Quantitative 1H NMR metabolomics reveals extensive metabolic reprogramming of primary and secondary metabolism in elicitor-treated opium poppy cell cultures" pptx

... pathway begins with the condensation of E4P and PEP, and links carbohydrate metabolism with aromatic amino acids and derivatives in plants and microorganisms through the formation of chorismate ... Legrand M, Heitz T: Spatio-temporal expression of patatin-like lipid acyl hydrolases and accumulation of jasmonates in elicitor-treated tobacco leaves are not affected by endogenous levels of ... cultures and induced by elicitor treatment Coumarate, an intermediate in phenylpropanoid metabolism and a derivative of phenylalanine, initially accumulated in both control and elicitor-treated cells,...

Ngày tải lên: 12/08/2014, 05:20

19 467 0
Studying the status of asthma in students at primary and secondary schools in Thai Nguyen city and the effectiveness of controlling asthma with ICS + LABA

Studying the status of asthma in students at primary and secondary schools in Thai Nguyen city and the effectiveness of controlling asthma with ICS + LABA

... type It is estimated 0.01 p1 is the rate of patients estimated asthma control of pretreatment It is estimated 30% p2 is proportion of patients estimated after treatment Estimation is 30% , 05 ... the rate of BA of pupils at school age, the rate of BA in Hai Phong in 2002 was 9.3% BA percentage of pupils at school age in urban and suburbs of Hanoi in 2005 was 10.42% Studies of pupils at ... 3.28 Variation of PEF morning - evening before and after treatment Before treatment, variation of PEF morning and night indexes is 27.6% After weeks and weeks of treatment, PEF variation decreases...

Ngày tải lên: 24/06/2015, 00:57

26 393 0
Quantification of primary and secondary oocyte production in atlantic cod by simple oocyte packing density theory

Quantification of primary and secondary oocyte production in atlantic cod by simple oocyte packing density theory

... approaches to assess maturity and fecundity of warm- and cold-water fish and squids Institute of Marine Research, Bergen, Norway Bancroft, J D., and A Stevens 1996 Theory and practice of histological ... of relative somatic fecundity (RFS ; determined as F/[W body – W ovary ]) and OPD (calculated as F/W ovary ) All scoring of oocyte phases or stages and the collection of information on OD and ovarian ... located at the periphery of the cytoplasm and has a patchy appearance 2011, this special issue) The time of initiation of vitellogenesis was related to the autumnal equinox (23 September 2002 and...

Ngày tải lên: 04/09/2015, 12:47

15 593 0
Báo cáo y học: " Real time analysis of b2-adrenoceptor-mediated signaling kinetics in Human Primary Airway Smooth Muscle Cells reveals both ligand and dose dependent differences" ppt

Báo cáo y học: " Real time analysis of b2-adrenoceptor-mediated signaling kinetics in Human Primary Airway Smooth Muscle Cells reveals both ligand and dose dependent differences" ppt

... differences in rate of onset of action of these drugs we explored the rate of cyclic Billington and Hall Respiratory Research 2011, 12:89 http://respiratory-research.com/content/12/1/89 Page of 10 Figure ... between rate of response and the lipophilicity of each compound with the expectation being that increased lipophilicity would correlate with a slower rate of response Although salmeterol and indacaterol ... data was the concentration-dependent effect of isoproterenol on the rate of b2-adrenoceptor-mediated Epac probe activation Two very recent studies report temporal data of b adrenoceptor-mediated...

Ngày tải lên: 12/08/2014, 13:22

10 309 0
(1) how learners approach learning, both in and out of classrooms, and (2) the kinds of strategies and cognitive processing they use in second language acquisition

(1) how learners approach learning, both in and out of classrooms, and (2) the kinds of strategies and cognitive processing they use in second language acquisition

... comprehensive classification of learning strategies to date” (p 539); and as Ellis stated: “the organization of specific strategies into a hierarchy of levels and the breadth of the taxonomy (Oxford’s ... is somewhat inevitable The choice of learning strategies would influence learners’ rate of acquisition and the ultimate level of achievement Learners’ success and their level of L2 proficiency ... each statement, they had to decide whether that statement is (1) “Never true of me”; (2) “Usually not true of me”, (3) “Somewhat true of me”, (4) “Usually true of me” or (5) “Always true of me”...

Ngày tải lên: 29/01/2014, 00:23

83 623 0
Tài liệu Báo cáo khoa học: Molecular and biochemical characterization ofD-phosphoglycerate dehydrogenase fromEntamoeba histolytica A unique enteric protozoan parasite that possesses both phosphorylated and nonphosphorylated serine metabolic pathways docx

Tài liệu Báo cáo khoa học: Molecular and biochemical characterization ofD-phosphoglycerate dehydrogenase fromEntamoeba histolytica A unique enteric protozoan parasite that possesses both phosphorylated and nonphosphorylated serine metabolic pathways docx

... biosynthetic pathway, molecular identification of enzymes and their genes located upstream of this pathway is essential We attempted to identify and characterize the putative serine metabolic pathway ... presence of high concentrations of NADP+ (0.4 mM) and 3-PGA (5–10 mM) Km for substrates of EhPGDH was similar to that of mammalian PGDH [11,13], and one to two orders lower than that of Ó FEBS ... mutagenesis of Trp139 to Gly resulted in the dissociation of the tetramer to a pair of dimers and in the loss of cooperativity in serine binding and inhibition [17,52] The truncated variant of rat liver...

Ngày tải lên: 19/02/2014, 13:20

12 464 0
Tài liệu Báo cáo khoa học: Gene transcription of fgl2 in endothelial cells is controlled by Ets-1 and Oct-1 and requires the presence of both Sp1 and Sp3 pdf

Tài liệu Báo cáo khoa học: Gene transcription of fgl2 in endothelial cells is controlled by Ets-1 and Oct-1 and requires the presence of both Sp1 and Sp3 pdf

... 5¢-TGT CGAATGCAAATCACTAGAA-3¢; Sp1, 5¢-ATTCGATC GGGGCGGGGCGAGC-3¢; Ets/Pea3, 5¢-GATCTCGAG CAGGAAGTTCGA-3¢; Ets (PU.1), 5¢-GGGCTGCTTG AGGAAGTATAAGAAT-3¢; Stat3, 5¢-GATCCTTCTG GGAATTCCTAGATC-3¢; and ... of extracts and cold probe are indicated in the top of the panel Supershift, ss-Sp1 and ss-Sp3, were shown in presence of anti-Sp1 and anti-Sp3 Ig Cold and mutated competitors are indicated at ... activity of 3¢-truncation of fgl2 promoter construct in endothelial cells The data is the average of at least three separate experiments each performed in triplicate The data was corrected for variations...

Ngày tải lên: 20/02/2014, 11:20

13 525 0
Tài liệu Báo cáo khoa học: "A Composite Kernel to Extract Relations between Entities with both Flat and Structured Features" ppt

Tài liệu Báo cáo khoa học: "A Composite Kernel to Extract Relations between Entities with both Flat and Structured Features" ppt

... 97 documents and 1386 relation instances The ACE 2003 data defines entity types, major relation types and 24 relation subtypes The ACE 2004 data contains 451 documents and 5702 relation instances ... are all somewhat effective for relation extraction This suggests that structured syntactic information has good predication power for relation extraction and the structured syntactic information ... data makes some modifications and introduces a new feature “LDC mention type” Our statistics on the ACE data reveals that the entity features impose a strong constraint on relation types Therefore,...

Ngày tải lên: 20/02/2014, 12:20

8 467 0
Tài liệu Smart Posters - How to use NFC tags and readers to create interactive experiences that benefit both consumers and businesses docx

Tài liệu Smart Posters - How to use NFC tags and readers to create interactive experiences that benefit both consumers and businesses docx

... alternative means of communication, relative ease of implementation, usage feedback, and the provision of an automated interactive communications mechanism to target audiences The opt-in nature of ... that implements at least the mandatory parts of the NFC Forum Protocol Stack and the mandatory NFC Forum Operating Modes and has received NFC Forum certification For more information, refer to ... Two organizations that provide internationally accepted standards across most fields NDEF – The NFC Forum’s NDEF (NFC Data Exchange Format) specification ensures a uniform format for data exchange...

Ngày tải lên: 21/02/2014, 05:20

25 591 0
Lay health workers in primary and community health care: A systematic review of trials pdf

Lay health workers in primary and community health care: A systematic review of trials pdf

... correlation coefficient (ICC) of 0.02 which is typical of primary and community care interventions (Campbell, 2000) Log relative risks and standard errors of the log relative risk were then calculated ... suggested that the outcomes were too diverse to allow statistical pooling This document updates the 2005 systematic review, focusing on the effects of LHW interventions in improving maternal and child ... use of lay health workers (LHWs) for the delivery of a wide range of maternal and child health (MCH) services in low and middle income countries (LMICs) However, robust evidence of the effects of...

Ngày tải lên: 05/03/2014, 10:20

86 502 1
CUPOLOGY. HOW TO BE ENTERTAINING. INTERESTING FACTS FOR BOTH YOUNG AND OLD. TOASTS -- GEMS. HOW TO TELL AGE. PUBLISHED docx

CUPOLOGY. HOW TO BE ENTERTAINING. INTERESTING FACTS FOR BOTH YOUNG AND OLD. TOASTS -- GEMS. HOW TO TELL AGE. PUBLISHED docx

... cheated me out of my rights so many times I was to have a reading that night at the home of Mrs M C for I served with hopes and glad expectations into each dainty cup of aromatic coffee that ... carnage and the smoke of battle to glory and renown; whose blood forms one of the ingredients that go to make the ink in which all history is written, and that finally, mutely and sadly, in black ... up a party and he is sure to forget that Mrs B was engaged to C before she married D., and that Mrs C is aware of the fact, and that the D.s and E.s have long been at daggers drawn, and he will...

Ngày tải lên: 06/03/2014, 12:21

72 427 0
Báo cáo khoa học: The signature amidase from Sulfolobus solfataricus belongs to the CX3C subgroup of enzymes cleaving both amides and nitriles Ser195 and Cys145 are predicted to be the active site nucleophiles pot

Báo cáo khoa học: The signature amidase from Sulfolobus solfataricus belongs to the CX3C subgroup of enzymes cleaving both amides and nitriles Ser195 and Cys145 are predicted to be the active site nucleophiles pot

... NcoFOR_1, 5¢-CTCTCC ATGGGAATTAAGTTACCCACATTGGAGGA-3¢, carrying the sequence for the NcoI restriction site, and a second oligonucleotide reverse primer K96R_rev, 5¢-ATATGTAT ACCCGCTATCATCACATTGTCCCTAATGCAAATCC ... nitriles ˚ Indeed, the sulfur atom of Cys145 is at about A ˚ from the Oc atom of Ser171 and 2.5 A from the amino group of Lys96 (Fig 4) This putative alternative triad is located in a different plane ... activating Ser171 (Fig 5B) One of its amino ˚ groups is about 2.6 A from the Oc atom of Ser171 ˚ and 2.5 A from the thiol group of Cys145 4720 Even taking into account all of the limitations of...

Ngày tải lên: 07/03/2014, 21:20

9 478 0
w