0
  1. Trang chủ >
  2. Ngoại Ngữ >
  3. Tổng hợp >

Design and development of a bioreactor for ligament tissue engineering

Design and development of a bioreactor for ligament tissue engineering

Design and development of a bioreactor for ligament tissue engineering

... (lateral collateral ligament and medial collateral ligament) , and two interior ligaments (anterior cruciate ligament (ACL) and posterior cruciate ligament) , which help control stabilisation and ... Rotating Wall Bioreactor 28 2.2.2.3 The Flow Perfusion Bioreactor 29 CHAPTER 3: DESIGN AND FABRICATION OF BIAXIAL MECHANICAL STIMULATION AND PERFUSION BIOREACTOR 32 3.1 DESIGN CRITERIA 32 3.2 MATERIAL ... field of tissue engineering has shown to be a promising alternative in using cell transplantation as a strategy to achieve tissue repair and regeneration for a variety of therapeutic needs One approach...
  • 141
  • 239
  • 0
Development of a bioreactor for in vitro engineering of soft tissues

Development of a bioreactor for in vitro engineering of soft tissues

... DEVELOPMENT OF A BIOREACTOR FOR IN- VITRO ENGINEERING OF SOFT TISSUES KYAW MOE (B.Eng (Hons.), YTU, Yangon) A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF ENGINEERING DEPARTMENT OF MECHANICAL ... through the chamber maintaining steady state Low inlet gas flow rates were maintained such that inexpensive commercially available CO2, O2, and N2 tanks would last for approximately weeks In this system, ... from National University of Singapore designed a bioreactor with spool The actuating unit from that design is made up of a stepper motor (PM 35S-024, Minebea Hamamatsu) actuating via a pair of spur...
  • 151
  • 253
  • 0
Hyperscsi  design and development of a new protocol for storage networking

Hyperscsi design and development of a new protocol for storage networking

... connection and data reliability mechanism A UDP datagram has a header and a payload The application data is carried as payload and the header carries the necessary information for protocol operation A ... volume of and the increasingly critical role played by data storage, there is a strong demand to put data storage on network Therefore, how to share data, improve data reliability, and back up and ... parameter to determine the total data transfer rate and packet loss ratio RBUDP separates the signaling control and data communication channel to achieve higher data transfer rate The analytical...
  • 169
  • 515
  • 0
Design and development of a CMOS power amplifier for digital applications

Design and development of a CMOS power amplifier for digital applications

... that make it acts as an open circuit and also the tank circuit appears to be a Design and Development of a CMOS Power Amplifier for Digital Applications 34 CHAPTER 3: Fundamentals of Power Amplifier ... Scattering Design and Development of a CMOS Power Amplifier for Digital Applications 40 CHAPTER 4: Power Amplifier: Design Implementation & Simulation parameters and also the admittance parameters of ... a CMOS Power Amplifier for Digital Applications 18 CHAPTER 3: Fundamentals of Power Amplifier bandwidth Hence, to measure the linearity of a power amplifier that is used to transmit a digital...
  • 103
  • 419
  • 0
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx

Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx

... used for RT-PCR were: for the I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCT AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC ... recombination introducing the c-myc-OR17-40 coding sequence, using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢) and (5¢-GCATGCCTGCAGG TCGACTCTAGAGGATCTCAAGCCAGTGACCGCCT ... AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC TCATCTCTGAAGAGGATCTG-3¢) and (5¢-GCATG CCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGT GACCGCCTCCC-3¢); for Golf (5¢-GGTACCGCTGCAA TGGGGTGTTTGGGCAAC-3¢) and (5¢-GCGGCCGCCT CAGATCACAAGAGTTCGTACTGC-3¢);...
  • 14
  • 473
  • 0
báo cáo hóa học:

báo cáo hóa học:" Research Article Design and Implementation of a Testbed for IEEE 802.15.4 (Zigbee) Performance Measurements" doc

... for that particular packet All of these packets are picked up by BaseStation.java listening on the USB port and it saves each consecutive packet in a file for future analysis A new file is created ... created for each trial A second Java program (Analyze.java) was developed to analyze the saved files containing the received packets Since the transmitted data is known, this program can easily calculate ... channel, the transmitter node always transmits the same data packet The first octets are AM BER = header information and the dummy data payload is decimal number 85 which was chosen simply because...
  • 11
  • 521
  • 0
Design and development of a medical parallel robotfor cardiopulmonary resuscitation

Design and development of a medical parallel robotfor cardiopulmonary resuscitation

... from medical aspects, a 3-PUU translational parallel manipulator was chosen and designed to satisfy the specific requirement The kinematic analysis was performed and the manipulatorreachable workspace ... represents an ∂R equation in a single variable R and allows the calculation of the values of R and H in sequence B Design Variables and Objective Function The architectural parameters of a 3-PUU ... the LI AND XU: DESIGN AND DEVELOPMENT OF A MEDICAL PARALLEL ROBOT FOR CARDIOPULMONARY RESUSCITATION 269 actuators locked, the moving platform of the TPM can still undergo infinitesimal translations...
  • 9
  • 472
  • 0
Design and implementation of a testbed for indoor mimo systems

Design and implementation of a testbed for indoor mimo systems

... channel In addition, w e only pay attention to uniform antenna arrays in this section, that is, all an tennas are aligned and equally separated in the tran sm it and receive antenna arrays 8 2.2.1 ... create b aseb and signal and m odulation type to be applied in the tran sm itter and to receive reco vered data signal for channel capacity co m p u tin g (figure 19) Both b aseb an d and IF parts ... creates a sine w ave o f 12.5M H z to shift base b a n d signal to IF band before passing through D ACs Figure 23: Baseband Transmitter Diagram a) Data G en erato r b) W alsh code G en erato...
  • 61
  • 354
  • 0
Design and development of a self balancing bicycle using control moment gyro

Design and development of a self balancing bicycle using control moment gyro

... moment gyro (CMG) as an actuator The control moment gyro (CMG) is typically used in a spacecraft to orient the vessel [5] Appling a CMG as an actuator to balance a bicycle is a creative and novel approach; ... provides a comparison of the various methods to balance a bicycle, evaluated their advantages and disadvantages The most significant contribution of this research is the use of a CMG as an actuator ... torque applied to the handlebar to balance the bicycle Advantages of such a system include low mass and low energy consumption Disadvantages of such as system is its lack of robustness against large...
  • 59
  • 1,288
  • 0
Design and development of a bench top electro adsorption chiller

Design and development of a bench top electro adsorption chiller

... chiller and the combined thermoelectric adsorption chiller 14 Chapter Design, development and fabrication of an electro- adsorption chiller Chapter Design, development and fabrication of an electro- adsorption ... 2.4 Electro- adsorption chiller (EAC) 11 2.4.1 Adsrobent- adesorbate pair 13 2.4.2 Performance of an electro- adsorption chiller 13 Chapter Design, development and fabrication of an electro- adsorption ... the details of each of the major components are described (Qext ) Figure 3.1 A schematic layout of an electro- adsorption chiller 15 Chapter Design, development and fabrication of an electro- adsorption...
  • 78
  • 382
  • 0
Design and development of a social robotic head   dorothy

Design and development of a social robotic head dorothy

... - Appearance & Abilities 31 Chapter – Our Design Approach Based on the study of social robotics and successful social robotic heads, we come up with an approach to designing Dorothy s appearance ... and Mr Sakthiyavan S/O Kuppusamy (Mechatronics & Control Lab 1, Department of Mechanical Engineering, National University of Singapore) Thanks for their assistance in financial affairs and fabrication ... human to certain degree The guideline of social robots’ appearances, capabilities and performance varies mainly as the purpose of the research or applications Table 13 summarizes the appearance...
  • 99
  • 347
  • 0
DESIGN AND DEVELOPMENT OF AN OMNIDIRECTIONAL MOBILE BASE FOR a SOCIAL ROBOT

DESIGN AND DEVELOPMENT OF AN OMNIDIRECTIONAL MOBILE BASE FOR a SOCIAL ROBOT

... Understand Behavioral layer target area speech Motion and Audio and Vision Speech Animation localization gestures task task task Mobile platform Speakers Camera/s Microphone/s Animated head and arms ... Example of social robot architecture for execution and robot behavioral layer 2.2 Review of mobile Robots The prevalence of automation and mobile robotic platform has seen a rise of demand for ... and we have to calculate the angle of each joint Robot kinematics can be divided in serial manipulator kinematics, parallel manipulator kinematics, mobile robot kinematics and humanoid kinematics...
  • 73
  • 337
  • 0
DESIGN AND DEVELOPMENT OF MEDICAL ELECTRONIC INSTRUMENTATION A Practical Perspective of the Design, Construction, and Test of Medical Devices docx

DESIGN AND DEVELOPMENT OF MEDICAL ELECTRONIC INSTRUMENTATION A Practical Perspective of the Design, Construction, and Test of Medical Devices docx

... DESIGN AND DEVELOPMENT OF MEDICAL ELECTRONIC INSTRUMENTATION DESIGN AND DEVELOPMENT OF MEDICAL ELECTRONIC INSTRUMENTATION A Practical Perspective of the Design, Construction, and Test of Medical ... synchronize the inflation and deflation of pressure suits adaptively to gain an increase in the level of gravitational accelerations that an airman is capable of tolerating Additional applications, such as ... however, may not be available in electronic format Library of Congress Cataloging-in-Publication Data: Prutchi, David Design and development of medical electronic instrumentation: a practical perspective...
  • 478
  • 522
  • 2
Báo cáo hóa học:

Báo cáo hóa học: " Design and Characterization of a 5.2 GHz/2.4 GHz ΣΔ Fractional-N Frequency Synthesizer for Low-Phase Noise Performance" potx

... simulations on the divider can be performed The crystal oscillator is normally a commercially available part and data on its phase noise performance is often available from the manufacturer The ΣΔ ... measured and simulated phase noise for the 3.2-3.3 GHz band The square dots are the simulated data synthesizer phase noise performance The model can serve as a design guide for synthesizer designers ... University of Central Florida under a Motorola Research Grant on SAW device package electrical characterization and oscillator design From 1991 to 1995, he was a Staff and Lead Oscillator Design Engineer...
  • 11
  • 416
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Design and Realization of a New Signal Security System for Multimedia Data Transmission" ppt

... This data- processing rate is fast enough for realtime data protection in multimedia data transmission applications The proposed signal security system is suitable for both software and hardware ... updating period of the parameters of µ and x(0) could be based on the basic unit of video frame or audio frame in representing the multimedia data A New Signal Security System for Multimedia Data ... the silicon area normalized to a 0.35 µm NArea = DRPA = Area (Technology/0.35)2 Data − rate NArea Mbps/mm2 (20) (21) A New Signal Security System for Multimedia Data Transmission ctrl vo 1301...
  • 15
  • 421
  • 0

Xem thêm

Từ khóa: the design and development of a solar powered refrigeratordesign and development of a productdesign and development of polymers for gene deliverydesign and development of polymers for gene delivery pdfdesign and implementation of a computer based inventory control system for a pharmaceutical storedesign and development of an automatic speech recognition system for urdudesign and development of self emulsifying lipid formulations for improving oral bioavailability of poorly water soluble and lipophilic drugsdesign and development of standards hl7 v3 based enterprise architecture for public health programs integration at the county of los angelesprinciples design and construction of a two photon laser scanning microscope for in vitro andbailey j pearson s 1983 development of a tool for measuring and analyzing computer user satisfaction management science 29 5 530 545support the design and development of an information systemon the design and development of program familiesthe design and development ofthe design and development of pegfilgrastim pegrmethugcsf neulastathe design and development of pegfilgrastimBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI