Design and development of a bioreactor for ligament tissue engineering
Design and development of a bioreactor for ligament tissue engineering
... (lateral collateral ligament and medial collateral ligament) , and two interior ligaments (anterior cruciate ligament (ACL) and posterior cruciate ligament) , which help control stabilisation and ... Rotating Wall Bioreactor 28 2.2.2.3 The Flow Perfusion Bioreactor 29 CHAPTER 3: DESIGN AND FABRICATION OF BIAXIAL MECHANICAL STIMULATION AND PERFUSION BIOREACTOR 32 3....
Ngày tải lên: 04/10/2015, 10:25
Development of a bioreactor for in vitro engineering of soft tissues
... DEVELOPMENT OF A BIOREACTOR FOR IN- VITRO ENGINEERING OF SOFT TISSUES KYAW MOE (B.Eng (Hons.), YTU, Yangon) A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF ENGINEERING DEPARTMENT OF MECHANICAL ... through the chamber maintaining steady state Low inlet gas flow rates were maintained such that inexpensive commercially available CO2, O2, and N2 tanks would last f...
Ngày tải lên: 04/10/2015, 15:46
Hyperscsi design and development of a new protocol for storage networking
... connection and data reliability mechanism A UDP datagram has a header and a payload The application data is carried as payload and the header carries the necessary information for protocol operation A ... volume of and the increasingly critical role played by data storage, there is a strong demand to put data storage on network Therefore, how to share data, improve...
Ngày tải lên: 16/09/2015, 15:54
Design and development of a CMOS power amplifier for digital applications
... that make it acts as an open circuit and also the tank circuit appears to be a Design and Development of a CMOS Power Amplifier for Digital Applications 34 CHAPTER 3: Fundamentals of Power Amplifier ... Scattering Design and Development of a CMOS Power Amplifier for Digital Applications 40 CHAPTER 4: Power Amplifier: Design Implementa...
Ngày tải lên: 04/10/2015, 10:25
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx
... used for RT-PCR were: for the I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCT AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC ... recombination introducing the c-myc-OR17-40 coding sequence, using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢) and (5¢-G...
Ngày tải lên: 07/03/2014, 16:20
báo cáo hóa học:" Research Article Design and Implementation of a Testbed for IEEE 802.15.4 (Zigbee) Performance Measurements" doc
... for that particular packet All of these packets are picked up by BaseStation.java listening on the USB port and it saves each consecutive packet in a file for future analysis A new file is created ... created for each trial A second Java program (Analyze.java) was developed to analyze the saved files containing the received packets Since the transmitted data is known, this progra...
Ngày tải lên: 21/06/2014, 18:20
Design and development of a medical parallel robotfor cardiopulmonary resuscitation
... from medical aspects, a 3-PUU translational parallel manipulator was chosen and designed to satisfy the specific requirement The kinematic analysis was performed and the manipulatorreachable workspace ... represents an ∂R equation in a single variable R and allows the calculation of the values of R and H in sequence B Design Variables and Objective Function The architec...
Ngày tải lên: 04/08/2014, 09:54
Design and implementation of a testbed for indoor mimo systems
... channel In addition, w e only pay attention to uniform antenna arrays in this section, that is, all an tennas are aligned and equally separated in the tran sm it and receive antenna arrays 8 2.2.1 ... create b aseb and signal and m odulation type to be applied in the tran sm itter and to receive reco vered data signal for channel capacity co m p u tin g (figure 19) Both b aseb an...
Ngày tải lên: 25/03/2015, 11:04
Design and development of a self balancing bicycle using control moment gyro
... moment gyro (CMG) as an actuator The control moment gyro (CMG) is typically used in a spacecraft to orient the vessel [5] Appling a CMG as an actuator to balance a bicycle is a creative and novel approach; ... provides a comparison of the various methods to balance a bicycle, evaluated their advantages and disadvantages The most significant contribution of thi...
Ngày tải lên: 02/10/2015, 17:14
Design and development of a bench top electro adsorption chiller
... chiller and the combined thermoelectric adsorption chiller 14 Chapter Design, development and fabrication of an electro- adsorption chiller Chapter Design, development and fabrication of an electro- adsorption ... 2.4 Electro- adsorption chiller (EAC) 11 2.4.1 Adsrobent- adesorbate pair 13 2.4.2 Performance of an electro- adsorption chiller 13 Chapter...
Ngày tải lên: 04/10/2015, 10:25
Design and development of a social robotic head dorothy
... - Appearance & Abilities 31 Chapter – Our Design Approach Based on the study of social robotics and successful social robotic heads, we come up with an approach to designing Dorothy s appearance ... and Mr Sakthiyavan S/O Kuppusamy (Mechatronics & Control Lab 1, Department of Mechanical Engineering, National University of Singapore) Thanks for their assistance in financial...
Ngày tải lên: 04/10/2015, 10:26
DESIGN AND DEVELOPMENT OF AN OMNIDIRECTIONAL MOBILE BASE FOR a SOCIAL ROBOT
... Understand Behavioral layer target area speech Motion and Audio and Vision Speech Animation localization gestures task task task Mobile platform Speakers Camera/s Microphone/s Animated head and arms ... Example of social robot architecture for execution and robot behavioral layer 2.2 Review of mobile Robots The prevalence of automation and mobile robotic platform...
Ngày tải lên: 04/10/2015, 10:26
DESIGN AND DEVELOPMENT OF MEDICAL ELECTRONIC INSTRUMENTATION A Practical Perspective of the Design, Construction, and Test of Medical Devices docx
... DESIGN AND DEVELOPMENT OF MEDICAL ELECTRONIC INSTRUMENTATION DESIGN AND DEVELOPMENT OF MEDICAL ELECTRONIC INSTRUMENTATION A Practical Perspective of the Design, Construction, and Test of Medical ... synchronize the inflation and deflation of pressure suits adaptively to gain an increase in the level of gravitational accelerations that...
Ngày tải lên: 29/03/2014, 11:20
Báo cáo hóa học: " Design and Characterization of a 5.2 GHz/2.4 GHz ΣΔ Fractional-N Frequency Synthesizer for Low-Phase Noise Performance" potx
... simulations on the divider can be performed The crystal oscillator is normally a commercially available part and data on its phase noise performance is often available from the manufacturer The ΣΔ ... measured and simulated phase noise for the 3.2-3.3 GHz band The square dots are the simulated data synthesizer phase noise performance The model can serve as a design guide...
Ngày tải lên: 22/06/2014, 22:20
Báo cáo hóa học: " Design and Realization of a New Signal Security System for Multimedia Data Transmission" ppt
... This data- processing rate is fast enough for realtime data protection in multimedia data transmission applications The proposed signal security system is suitable for both software and hardware ... updating period of the parameters of µ and x(0) could be based on the basic unit of video frame or audio frame in representing the multimedia data A New Signal...
Ngày tải lên: 23/06/2014, 01:20