... input parameters and provide you automatically with a schematic dia-
gram and calculate capacitor and resistor values for specific filter implementations. This
doesn’t mean that the programs will ... 12:35 PM Page xiv
In memory of Prof. Mircea Arcan,
who was a caring teacher, a true friend,
and a most compassionate human being.
—David
ffirs.qxd 11/22/2004 9:46 AM Page v
1
1
Design andDevelopment ... a capacitance of 5000 pF at
12 BIOPOTENTIAL AMPLIFIERS
Figure 1.10 Block diagram ofa typical capacitive active bioelectrode. A highly dielectric material
is used to form a capacitive interface...
... The bandwidth of each of the five phases is
shown separately. Sprite LFS has a higher write bandwidth and
the same read bandwidth as SunOS with the exception of sequen-
tial reading ofa file that ... log as the most up to date ‘‘truth’’ about
the state of the data on disk. The main difference is that
database systems do not use the log as the final repository
for data: a separate data area is ... in part
by the National Aeronautics and Space Administration and the
Defense Advanced Research Projects Agency under contract
NAG2-591.
This paper will appear in the Proceedings of the 13th ACM...
... A2 8 Gareth S Roberts
6. The MATLAB design
The MATLAB design constructed is used to simulate the final FO control design where
all parameters, processes and variables are modelled mathematically. ... mathematically. Furthermore, the
MATLAB program can convert a MATLAB design into a C-code design in a relatively
straightforward manner. Hence, this stage of the thesis project is seen to be of great ... induction machine is an electrical device. The electrical properties that are of
particular interest to this thesis project are the stator and rotor’s resistance and
inductance, as well as the magnetizing...
... major parameters of the device. Only the ratio of parasitic capacitance and sensing capacitance can be
measured, and the estimated value is calculated assuming a total sensing capacitance of 60fF. ... of 60fF. Parasitic
capacitance and mismatch of sensing capacitance is measured in a way as shown in Figure 5.4. The capac-
itance ratios are derived from the ratios of driving signals and buffer ... C
f1
and C
f2
are reset to zero charge, and hold
capacitors C
h
’s are floating. During the Integrate 1 phase, the difference of charges on C
i1
and C
i2
are inte-
grated to C
f1
and C
f2
, and...
... performed on a probe station. Table 1
lists major parameters of the device. Only the ratio of parasitic capacitance and sensing capacitance can be
measured, and the estimated value is calculated assuming ... assuming a total sensing capacitance of 60fF. Parasitic
capacitance and mismatch of sensing capacitance is measured in a way as shown in Figure 5.4. The capac-
itance ratios are derived from the ratios ... value of these parasitic capacitors is around 70fF, which is the same order as the total sensing
capacitance. Parasitic capacitance of diodes and input transistors of buffers is relatively small,...
... stream!
Amsterdam
Chicago 2
Chicago 1
Fairness and Friendliness
50 TCP flows and 4
UDT flows between
SARA and StarLight
Realtime snapshot of
the throughput
The 4 UDT flows
have similar ... copy avoidance
ã
Overlapped IO
ã
Data scattering/gathering
ã
Speculation of next packet
Protocol Buffer Protocol Buffer
User Buffer
Data
New Data
Experiences in Designand Implementation
of a ...
Internet
AIMD (Additive Increase Multiplicative
Decrease)
ã
Fair: max-min fairness
ã
Stable: globally asynchronously stable
ã
But, inefficient and not scalable
In grid networks (with high bandwidth-delay...
... implemen-
tations and (2) automating many common network program-
ming tasks, such as object registration, location, and acti-
vation; request demultiplexing; framing and error-handling;
parameter marshalling ... T. Ralya, B. Pollak, R. Obenza, and M. G. Har-
bour, A Practitioner’sHandbook for Real-Time Analysis: Guide
to Rate Monotonic Analysis for Real-Time Systems. Norwell,
Massachusetts: Kluwer Academic ... Performance ofa Real-time CORBA Event Service,”
in Proceedings of OOPSLA ’97, (Atlanta, GA), ACM, October
1997.
[3] G. Parulkar, D. C. Schmidt, E. Kraemer, J. Turner, and
A. Kantawala, “An Architecture...
... facilitates
memorization.
152
DESIGNAND IMPLEMENTATION OFA LLXICAL DATA BASE
Eric Wehrli
Department of Linguistics
U.C.L .A.
405 Hilgard Ave, Los Angeles, CA 90024
ABSTRACT
This paper ... requirements"
and has to do with the complexity of the task of
creating a lexical entry. It can roughly be viewed
as a measure of the time it takes to create a new
lexical entry, andof the amount of ...
For instance, a translation system or any other
type of natural language processing program that
must be able to handle very large amounts of text
necessitates dictionaries of substantial size,...
... (5Â-AG
CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA
TTTTGCTGCC-3Â); for OR17-40 (5Â-CGTCAAGGAG
AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC
TCATCTCTGAAGAGGATCTG-3Â) and (5Â-GCATG
CCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGT
GACCGCCTCCC-3Â); ... was performed on DNAse-
treated RNA extracts. Primers used for RT-PCR were: for
the I7 OR (5Â-CGTCAAGGAGAAAAAACCCCGGATCT
AAAAAATGGAGCGAAGGAACCACAG-3Â) and (5Â-AG
CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA
TTTTGCTGCC-3Â); ... expression
vector was obtained from pJH2-SSTR2 by homologous
recombination introducing the c-myc-OR17-40 coding
sequence, using primers (5Â-CGTCAAGGAGAAAAAAC
CCCGGATCTAAAA AATGGAGC AGAAA CTCATCTC
TGAAGAGGATCTG...
... object-relational
database system Illustra [I11941 provides database support for
time-series data along with relational data. A time-series is
an ADT(Abstract Data Type) value implemented a& amp; a large ...
Catalog Management:
Each E-ADT can provide catalogs
that maintain statistics and store schema information. Further,
certain values may be named.
Query Language:
An E-ADT can provide a query ... Livny and Raghu Ramakrishnan
were supported by NASA Research Grant NAGW-3921. Raghu Ranxkish-
nan was also suppofled by a Packard Foundation Fellowship in Science and
Engineering, a Presidential...
... Space Application,
Bologna (Italy) (1979) 7A.
[4] Dang Thi Thanh Thuy, Pham Van Thanh, Nguyen Anh Tuan, Bach Gia Duong, Research, DesignAnd Fabrication Of
The 45W And The 200W, L-Band Power Amplifier ... combination technique in the microwave technology.
The designand simulink of the basic power moduls and Wilkinson bridge were performed using
the ADS soflware. We have researched, designed and ...
Bach Gia Duong
2
1
Faculty of Physics, College of Science, Vietnam National University Hanoi
2
Research Center Electronics and Telecommunication, College of Technology, VNU
3
Department of...
... metallo-endoprotease of
Serratia marcescens (serralysin), are the alkaline protei-
nase of Pseudomonas aeruginosa, the ZapA metallo-
protease of Proteus mirabilis and proetases A, B, C,
G and W of various ... Shibuya Y, Nishino N,
Tanase S, Miyauchi Y & Kambara T (1992) Activation
of human plasma prekallikrein by Pseudomonas aerugi-
nosa elastase. II. Kinetic analysis and identification of
scissile ... (horizontal double arrows, A1 A5 ) in the sequence
of insulin chain A. (B) Change over time in the chromatographic
peak area of cleavage fragments. Note that the amount of frag-
ments A1 , A2 and A4 ...
... Private Network
WAP Wireless Application Protocol
WDP Wireless Datagram Protocol
XIP Execute in place
Glossary of Terms
ABI Application binary interface
ADT Abstract data type
BAL Bearer Abstraction ... summer of 1994, Psion was a company of perhaps 40 software
engineers and as many hardware engineers, with aproduct line of
handheld organizers that was highly profitable. The most recent was the
Psion ... followed by Asia, including Hong Kong, Australia and
New Zealand. By the mid-1990s, new GSM networks had sprung up
globally from the Philippines and Thailand to Iran, Morocco, Latvia
and Russia, as well...