De novo genome assembly using paired end short reads

... eukaryotic genomes 18 2.5 EULER-USR EULER-USR [5] is in many ways similar to Velvet It is a set of tools designed to carry out de novo assembly of paired and non -paired short reads using the De Bruijn ... this is not attainable using reads as short as 25bp Finally, they were not explicitly designed to take advantage of paired reads Therefore new approaches were nee...

Ngày tải lên: 04/10/2015, 10:25

... Assisted assembly algorithm The assisted assembly process starts by simultaneously building a de novo assembly from the reads and by aligning the same reads to one or more related genomes These alignments ... MW, Vaidya AB, Martin DM, et al.: Genome sequence of the human malaria parasite Plasmodium falciparum Nature 2002, 419:498-511 Nagarajan N, Read TD, Pop M: Scaffold...

Ngày tải lên: 09/08/2014, 20:20

... Velvet preassembly (Sanger -454- IlluminaPA); and incorporating the Illumina PE data directly (Sanger -454- IlluminaDA) EST-to -genome sequence alignments and Illumina PE read alignment cluster analysis ... was a more accurate assembly in regards to long range continuity (Figure 3) The Sanger -454- IlluminaDA assembly had greater contig N50 whereas the Sanger -454- IlluminaPA...

Ngày tải lên: 09/08/2014, 20:20

... PETA and UASIS, to interpret and analyze large scale of Next Generation Sequencing data They serve as fundamental components to provide accurate transcriptomes and better data management for related ... PETA (Paired End Transcriptome Assembler) We claim that the full utilization of raw reads and paired- end information is able to construct a cleaner splicing grap...

Ngày tải lên: 01/10/2015, 17:28

... cooperation of Dnmt3a and Dnmt1 in de novo methylation of DNA that can only be provided by in vitro experiments In this model Dnmt3a is targeted to a domain of the DNA that is subject to de novo methylation ... methyl groups are always introduced, one slowly by Dnmt3a or by de novo methylation catalyzed by Dnmt1 and the second one very fast Therefore,...

Ngày tải lên: 21/02/2014, 01:21

... Acceleration of disulfide-coupled protein folding M Okumura et al is widely employed in studies of folding reactions of disulfide-containing proteins in vitro [3,4] Generally, folding reactions ... Journal compilation ª 2011 FEBS of 1139 Acceleration of disulfide-coupled protein folding M Okumura et al for the folding of prouroguanylin, as well as for the foldi...

Ngày tải lên: 06/03/2014, 00:21

... oligonucleotides: 5Â-GGTTA TATTGCCAAGAACTATAACTGTGCATAC-3Â, 5Â-C ATTGTTTAAAAATCTCCTCAGGCTGCGACACTTT A- 3Â, and 5Â-ACGAGTGGCCACTGCGGACATAAATC TGGACACGGAAGTGCCTGCTGG-3Â, respectively Production of recombinant ... electrophysiological properties partially comparable with those of BomIV, an a- like scorpion toxin Implications of that particular functional anatomy elucidation regar...

Ngày tải lên: 08/03/2014, 23:20

... information of the role of aromatic moieties in amyloid fibril formation [36–41] A parameter-free model based on the mathematical analysis of many peptide fragments and their analogues had clearly ... short fragments, such as the pentapeptide fragments of the human calcitonin peptide and IAPP (Table 1), rapidly and efficiently form typical amyloid fibrils Despite ha...

Ngày tải lên: 23/03/2014, 11:20

... K, Oda H, Nakajima H, Urade Y & Endo T (2000) Comparative study of the asparagine-linked sugar chains of human lipocalin-type prostaglandin D synthase purified from urine and amniotic fluid, and ... affinity-purified L-PGDS protein was separated by SDS-PAGE and transferred onto a polyvinylidine difluoride membrane The blots were stained with Coomassie brilliant blue The prote...

Ngày tải lên: 30/03/2014, 01:20

... observed in the second passage of the synthetic prions [3] Several lines of experimental evidence are consistent with the adaptation hypothesis Among them is the fact that the amyloid fibrils of rPrP89–230 ... dramatically in the course of adaptation The ‘maturation’ and ‘adaptation’ hypotheses are not mutually exclusive of each other Future studies should determine whe...

Ngày tải lên: 30/03/2014, 09:20

... ATATACGAGGTTAGTTCATTC TAATACGACTCACTATAGGGTGCCATGAA CAG GTGCCATGAACAGCAGAGATTTTTATAC TAGCCATGCCCATAGTAGG ATCAGGTCGTACTCCCATCAC TAATACGACTCACTATAGCGCGGGTAAC GCGCGGGTAACCCGGGATCTGAA GGGCCGTTAGGAAATTACCTTAGTC ... GAAGATCTTAATGATGATGATGATGATG GCTGCCATTGTACCTGTCTGCCCCTT ATCAGGAGACCAGCAGCCCCGCACACAT ATGTGTGCGGGGCTGCTGGTCTCCTGAT GTATACGAGGTTAGTTCATTC CTATACGAGGTTAGTTCATTC TTATACGAGGTTAGTTCATTC ATATA...

Ngày tải lên: 30/03/2014, 20:20

... 10.1186/gb-2010-11-2-r22 Cite this article as: Li et al., ChIA-PET tool for comprehensive chromatin interaction analysis with paired-end tag sequencing Genome Biology 2010, 11:R22 ... capture-on-chip (4C) Nat Genet 2006, 38:1348-1354 18 ChIA-PET Tool for Comprehensive Chromatin Interaction Analysis with Paired-End Tag Sequencing [http://chiapet.gis.a-star.e...

Ngày tải lên: 09/08/2014, 20:21

... assembly by localised assembly of reads at real gaps and regions that were previously unresolved in the assembly; and it uses iterative rounds of gathering reads and reassembles them to span gaps to ... 10.1186/gb-2010-11-4-r41 Cite this article as: Tsai et al., Improving draft assemblies by iterative mapping and assembly of short reads to eli...

Ngày tải lên: 09/08/2014, 20:21

... of each primer (forward, TMPRSS2 exon - TAGGCGC GAGCTAAGCAGGAG; reverse, ERG exon GTAGGCACACTCAAACAACGACTGG; as published by Tomlins et al [23]) and 50 ng cDNA at an annealing temperature (Ta) ... statistical significance are mandatory FusionSeq: a modular framework In the current study, we describe FusionSeq, a novel computational and statistical framework to identify fusion tran...

Ngày tải lên: 09/08/2014, 22:23

... non-pathogenic strains [50] The analysis of the gene content of the genome assembly shows that it shares many of the characteristics of similar plant pathogenic fungi, and strong homology to ... karyotypes of the phytopathogenic Pyrenophora graminea and P teres Mycol Res 2000, 104:853-857 46 Mehrabi R, Taga M, Kema GHJ: Electrophoretic and cytological karyotyping...

Ngày tải lên: 09/08/2014, 22:23