Design and analysis of object replacement policies on dynamic data allocation and replication algorithm with buffer constraints

Design and analysis of object replacement policies on dynamic data allocation and replication algorithm with buffer constraints

Design and analysis of object replacement policies on dynamic data allocation and replication algorithm with buffer constraints

... of data allocation and replication, a data allocation and replication algorithm solves three fundamental questions: Which object should be replicated? How Chapter Introduction many replicas of ... Chapter Data Allocation and Replication with Finite-size Buffer Constraints 35 Thus, an extra cost of control-message is needed to inform the CCU of the change...

Ngày tải lên: 04/10/2015, 10:24

104 317 0
Design and analysis of object allocation and replication algorithms in distributed databases for stationary and mobile computing systems

Design and analysis of object allocation and replication algorithms in distributed databases for stationary and mobile computing systems

... insights on designing object allocation and replication strategies for DDBSs In conclusion, our research contribution lies in designing adaptive object allocation and replication algorithms and ... Environments In this chapter, we address the object allocation and replication issues of OMP in DDBSs in the application domain of SCEs Designing an inte...

Ngày tải lên: 16/09/2015, 17:11

134 354 0
A comparative analysis of institutions, national policies, and cooperative responses to floods in Asia

A comparative analysis of institutions, national policies, and cooperative responses to floods in Asia

... _ Institutional Capacity in Natural Disaster Risk Reduction: A Comparative Analysis of Institutions, National Policies, and Cooperative Responses to Floods in Asia 2005-01-CMY-Nikitina Final ... countries of Asia 3.3.2 Asia: a variety of national institutional designs A variety of institutional frameworks to counteract floods are in place in...

Ngày tải lên: 22/10/2013, 10:15

39 537 1
Báo cáo y học: " Antibody microarray analysis of cell surface antigens on CD4+ and CD8+ T cells from HIV+ individuals correlates with disease stages" ppt

Báo cáo y học: " Antibody microarray analysis of cell surface antigens on CD4+ and CD8+ T cells from HIV+ individuals correlates with disease stages" ppt

... lack of activation and expression of CD38 and HLA-DR on CD4+ T cells correlates with long-term non-progression [9] The enumeration of CD4+ T- lymphocytes by flow cytometry is used routinely in the ... infection [41] These findings, together with ours, support the hypothesis that the CD8+ T cells from LNTP may have stronger cytotoxic activity than those from...

Ngày tải lên: 13/08/2014, 05:22

13 290 0
Báo cáo y học: "An updated study-level meta-analysis of randomised controlled trials on proning in ARDS and acute lung injury" pps

Báo cáo y học: "An updated study-level meta-analysis of randomised controlled trials on proning in ARDS and acute lung injury" pps

... setting of early studies on prone ventilation, ecological bias consisted of variable prone duration, mixed severity of acute lung injury, variable time-lapse between lung injury onset and inclusion, ... patients (ARDS only, excluding acute lung injury (ALI) non -ARDS patients), and control for the most relevant confounders - that is, proning duration (usually >17 hou...

Ngày tải lên: 14/08/2014, 07:21

9 311 0
Reliability analysis of power system based on generalized stochastic petri nets

Reliability analysis of power system based on generalized stochastic petri nets

... interconnections symbolize the logical interactions The construction rule for each sub-block follows two steps: 1) Identification and description of states (configurations); 2) Specification of transitions ... the stochastic transitions were supposed to have constant probability of firing However, there is a strong correlation between the operating conditions of power systems and the...

Ngày tải lên: 03/01/2014, 19:35

6 339 0
Báo cáo khoa học: Analysis of DNA-binding sites on Mhr1, a yeast mitochondrial ATP-independent homologous pairing protein potx

Báo cáo khoa học: Analysis of DNA-binding sites on Mhr1, a yeast mitochondrial ATP-independent homologous pairing protein potx

... W16 5A W16 9A W17 8A L6 6A R6 7A R6 8A D6 9A I7 0A K7 2A C7 3A S16 2A I163Ab Y16 4A E16 6A D16 7A P16 8A R17 0A G17 2A R6 2A ⁄ K6 3A R6 7A ⁄ R6 8A R6 7A ⁄ R6 8A ⁄ K7 2A K15 9A ⁄ K16 0A a )MgCl2 ss Normal conditiona ss ... ssDNA (5¢-ACGGGTGGGGTGGACATTGAC GAAGGCTTGGAAGACTTTCCGCCGGAGGAGGAGT TGCCGTTTTAATAAGGATC-3¢) (Hokkaido System Science, Hokkaido, Japan) and /X174 cir...

Ngày tải lên: 06/03/2014, 09:22

13 447 0
An Analysis of Database Workload Performance on Simultaneous Multithreaded Processors potx

An Analysis of Database Workload Performance on Simultaneous Multithreaded Processors potx

... optimizations for improving TPC-C performance on Digital AlphaServers Conclusions This paper explored the behavior of database workloads on simultaneous multithreaded processors, concentrating ... (including modelling of I/O), and synchronization The database workload On- line transaction processing (OLTP) and decision support systems (DSS) dominate the workloads handled...

Ngày tải lên: 07/03/2014, 14:20

12 406 0
Techno-Economic Analysis of Biofuels Production Based on Gasification docx

Techno-Economic Analysis of Biofuels Production Based on Gasification docx

... Techno-Economic Analysis of Biofuels Production Based on Gasification Ryan M Swanson, Justinus A Satrio, and Robert C Brown Iowa State University Alexandru Platon ConocoPhillips ... a tax of approximately $90 per metric ton of carbon A more recent study by Larson et al of switchgrass-to-hydrocarbons production in 2009 reports a production cost of $15.3/GJ ($1.90/ga...

Ngày tải lên: 31/03/2014, 07:20

165 625 1
báo cáo hóa học:" The HIV-1 Non-subtype B Workgroup: An International Collaboration for the Collection and Analysis of HIV-1 Non-subtype B Data" pot

báo cáo hóa học:" The HIV-1 Non-subtype B Workgroup: An International Collaboration for the Collection and Analysis of HIV-1 Non-subtype B Data" pot

... drug resistance will need to be continuously updated The < /b> International Non-subtype < /b> B Workgroup We have established an international workgroup for the < /b> collection and analysis of RT and protease ... HIV-1 < /b> subtype-related differences in genotypic evolution: analysis of subtypes B and C reverse transcriptase and protease sequences Program...

Ngày tải lên: 20/06/2014, 08:20

3 332 0
Báo cáo hóa học: " Morphology Analysis of Si Island Arrays on Si(001)" doc

Báo cáo hóa học: " Morphology Analysis of Si Island Arrays on Si(001)" doc

... the stronger the intensity at the corresponding position in the Nu(m) distribution The polar plots confirm that most of the island sidewall facets in the arrays lie along the x and y axes of the ... that play a key role on the formation of these Si island arrays, we have carried out a detailed study of their morphology features, in particular island size and facet distri...

Ngày tải lên: 21/06/2014, 08:20

6 231 0
Báo cáo hóa học: " Statistical Analysis of Surface Reconstruction Domains on InAs Wetting Layer Preceding Quantum Dot Formation" pot

Báo cáo hóa học: " Statistical Analysis of Surface Reconstruction Domains on InAs Wetting Layer Preceding Quantum Dot Formation" pot

... (1x3)/(2x3) domains (2x4) domains Ordered pattern Envelope of Poisson patterns Fig Nearest neighbor distance function p(t) of surface reconstruction domains on InAs WL as well as that of typical ... cm-2) of InAs QD precursors nucleating afterward, it implies the possibility that a QD formation pattern is based on the distribution of surface reconstruction dom...

Ngày tải lên: 21/06/2014, 08:20

4 242 0
Báo cáo hóa học: " Research Article Geometry Unit for Analysis of Warped Image Features on Programmable Chips" ppt

Báo cáo hóa học: " Research Article Geometry Unit for Analysis of Warped Image Features on Programmable Chips" ppt

... The GEO unit features backward transformation and interpolation of the arbitrarily formed image regions In this context, a region is defined as a set of points Therefore, a specific region is described ... Rectification of a general linear deformation with three tie-points APPLICATION OF THE GEOMETRY UNIT FOR TIE-POINT SEARCH Localization of typical patters (templates) with...

Ngày tải lên: 22/06/2014, 22:20

8 430 0
Báo cáo chuyên đề xây dựng " A Numerical Analysis of The Wave Forces on Vertical Cylinders by Boundary Element Method " potx

Báo cáo chuyên đề xây dựng " A Numerical Analysis of The Wave Forces on Vertical Cylinders by Boundary Element Method " potx

... (1974)  As the wave number ka increases The wave forces on the cylinders oscillate around the wave forces on an isolated cylinder  As the cylinder spacing increases, the wave force on the cylinders ... Remarks  The wave forces acting on two cylinders and three cylinders are computed by using boundary element method The numerical r...

Ngày tải lên: 26/07/2014, 07:20

29 422 0
Báo cáo y học: "Longitudinal microarray analysis of cell surface antigens on peripheral blood mononuclear cells from HIV+ individuals on highly active antiretroviral therapy" doc

Báo cáo y học: "Longitudinal microarray analysis of cell surface antigens on peripheral blood mononuclear cells from HIV+ individuals on highly active antiretroviral therapy" doc

... therapy by flow cytometry, this study is the first to use a cell- based antibody microarray (135 antigens) to retrospectively and longitudinally monitor the effect of antiretroviral therapy on cell ... Dwyer DE, Saksena NK: Antibody microarray analysis of cell surface antigens on CD4+ and CD8+ T cells from HIV+ individuals correlates with disease stages Retro...

Ngày tải lên: 13/08/2014, 06:20

12 218 0
w