Comparative study of u NU and sihanouk

Comparative study of u NU and sihanouk

Comparative study of u NU and sihanouk

... politics that ensured each would face an uphill struggle for legitimacy and effective control throughout much of their careers Although U Nu and Sihanouk were brought onto the scene to quell political ... neighbours and superpowers alike While their understanding and approach to foreign policy were influenced in different ways, both U Nu and Sihanouk inherited the task...
Ngày tải lên : 03/10/2015, 20:58
  • 175
  • 623
  • 0
Báo cáo y học: "Comparative study of serum Na+ and K+ levels in senile cataract patients and normal individuals"

Báo cáo y học: "Comparative study of serum Na+ and K+ levels in senile cataract patients and normal individuals"

... respectively Age range of patients and controls were 44-85 year and 43-86 year respectively Table shows serum Na+, K+ of case and control groups, with a significant difference in serum + Na of case and ... and control ones Table Comparison of Mean & SD of serum Na+, K+ in 155 patients with cataract and 155 without cataract Study group Serum Ag...
Ngày tải lên : 03/11/2012, 09:49
  • 5
  • 611
  • 1
A comparative study of discourse structures and some major linguistic features of international declarations and international conventions on human rights part 2

A comparative study of discourse structures and some major linguistic features of international declarations and international conventions on human rights part 2

... LINGUISTIC FEATURES OF THE INTERNATIONAL CONVENTION ON HUMAN RIGHTS IN COMPARISON WITH THOSE OF THE INTERNATIONAL DECLARATION 4.1 Definition of an International Convention 4 .2 20 Purposes and typical ... Preamble of the Convention and their realization 4.3.1 21 23 The Body 23 4.3 .2. 1 The Body of the Convention and its realization 23 4.3 .2. 2 Remarks 2...
Ngày tải lên : 07/11/2012, 14:17
  • 6
  • 634
  • 0
A comparative study of discourse structures and some major linguistic features of international declarations and international conventions on human rights part  3

A comparative study of discourse structures and some major linguistic features of international declarations and international conventions on human rights part 3

... differences between international Declarations and Conventions 32 in terms of discourse structures and major linguistic features International Declarations and International Conventions are legal documents, ... Convention 4 .3 A STUDY OF THE DISCOURSE STRUCTURE AND MAJOR LINGUISTIC FEATURES OF INTERNATIONAL CONVENTIONS ON HUMAN RIGH...
Ngày tải lên : 07/11/2012, 14:17
  • 41
  • 839
  • 3
A comparative study of discourse structures and some major linguistic features of international declarations and international conventions on human rights part  4

A comparative study of discourse structures and some major linguistic features of international declarations and international conventions on human rights part 4

... spirit of article 29; (b) Encourage international co-operation in the production, exchange and dissemination of such information and material from a diversity of cultural, national and international ... education accessible to all on the basis of capacity by every appropriate means; (d) Make educational and vocational information and guidance available and accessib...
Ngày tải lên : 07/11/2012, 14:17
  • 28
  • 611
  • 0
Báo cáo khoa học: "A Comparative Study of Hypothesis Alignment and its Improvement for Machine Translation System Combination" pot

Báo cáo khoa học: "A Comparative Study of Hypothesis Alignment and its Improvement for Machine Translation System Combination" pot

... Indirect-HMM-based Hypothesis Alignment for Combining Outputs from Machine Translation Systems In Proceeding of EMNLP Hawaii, US, Oct F Huang and K Papinent 2007 Hierarchical System Combination for Machine Translation ... word alignments are ready, we start from the intersection of the two word alignments, and then continuously add new links between backbone and h...
Ngày tải lên : 17/03/2014, 01:20
  • 8
  • 546
  • 1
Báo cáo khoa học: A comparative study of type I and type II tryparedoxin peroxidases in Leishmania major pot

Báo cáo khoa học: A comparative study of type I and type II tryparedoxin peroxidases in Leishmania major pot

... TATATCATATGTCTATCTACGACTTCAAGGTC ATATAGGATCCTCACGATTGAGTGCTTGG ATATATCATATGTCCGGTGTCGCAAAG ATATAGGATCCTTACTCGTCTCTCCACGG ATATATCATATGTCCTGCGGTAACGCC ATATAGGATCCTTACTGCTTGCTGAAGTATC CAACGTAGCCAGCAAGGCCGGCTTCACCAAGGGCG ... Heterologous priming-boosting with DNA and modied vaccinia virus Ankara expressing tryparedoxin peroxidase promotes long-term memory against Leishmania major in sus...
Ngày tải lên : 23/03/2014, 07:20
  • 16
  • 483
  • 0
Báo cáo hóa học: "Research Article Comparative Study of Local SAD and Dynamic Programming for Stereo Processing Using Dedicated Hardware" ppt

Báo cáo hóa học: "Research Article Comparative Study of Local SAD and Dynamic Programming for Stereo Processing Using Dedicated Hardware" ppt

... of SAD and the proposed version of dynamic programming stereo algorithm is given The hardware design of both systems is presented In Section the hardware/software platform used to prototype and ... methods, using techniques like SAD [6, 7] and rank transforms [16] Ambrosch and coauthors have recently implemented SAD- based stereo matching using FPGAs [17] They a...
Ngày tải lên : 21/06/2014, 19:20
  • 18
  • 350
  • 0
Báo cáo khoa học: "Comparative study of PM2.5 - and PM10 - induced oxidative stress in rat lung epithelial cells" pptx

Báo cáo khoa học: "Comparative study of PM2.5 - and PM10 - induced oxidative stress in rat lung epithelial cells" pptx

... mRNA induced by Comparative study of PM2.5 - and PM10 - induced oxidative stress in rat lung epithelial cells 15 Fig RT-PCR analysis of catalase mRNA The level of catalase mRNA induced by PM2.5 ... and Comparative study of PM2.5 - and PM10 - induced oxidative stress in rat lung epithelial cells 13 TTGTTTCTCGT-3', MTH1...
Ngày tải lên : 07/08/2014, 17:22
  • 8
  • 442
  • 1
báo cáo khoa học: " Medical tourism and policy implications for health systems: a conceptual framework from a comparative study of Thailand, Singapore and Malaysia" pot

báo cáo khoa học: " Medical tourism and policy implications for health systems: a conceptual framework from a comparative study of Thailand, Singapore and Malaysia" pot

... Singapore, Thailand and Malaysia as the three main hubs for medical tourism in Southeast Asia for comparative analysis Broadly, there are four types of comparative health policy analyses The first ... decades This paper presents a conceptual framework (Figure 1) that identifies the policy implications of medical tourism for health systems, from a...
Ngày tải lên : 11/08/2014, 14:21
  • 12
  • 463
  • 0
Validation of chemical looping with oxygen uncoupling (CLOU) using cu based oxygen carrier and comparative study of cu, mn and co based oxygen carriers using ASPEN plus

Validation of chemical looping with oxygen uncoupling (CLOU) using cu based oxygen carrier and comparative study of cu, mn and co based oxygen carriers using ASPEN plus

... performance of three – Copper (Cu) , Manganese (Mn) and Cobalt (Co) based oxygen carriers in the CLOU process Process simulations in ASPEN plus ASPEN Plus is a process simulation software which ... are however 1500 l/h and 1800 l/h with Co3 O4/CoO and Mn2 O3 /Mn3 O4 as OC respectively Tables and summarize the power output for three types of coal using Co 3O4/...
Ngày tải lên : 09/09/2015, 10:17
  • 8
  • 144
  • 0
A comparative study of the biological and physical properties of viscosity enhanced root repair material (VERRM) AND MTA

A comparative study of the biological and physical properties of viscosity enhanced root repair material (VERRM) AND MTA

... A COMPARATIVE STUDY OF THE BIOLOGICAL AND PHYSICAL PROPERTIES OF VISCOSITY ENHANCED ROOT REPAIR MATERIAL (VERRM) AND MTA PALLAVI UPPANGALA (BDS RGUHS, India) A THESIS SUBMITTED FOR THE DEGREE ... Maxillofacial Surgery, Faculty of Dentistry Thesis Title: A comparative study of the biological and physical properties of Viscosity...
Ngày tải lên : 15/09/2015, 22:51
  • 95
  • 778
  • 0
A comparative study of singapores chinatown and bangkoks chinatown

A comparative study of singapores chinatown and bangkoks chinatown

... Street) and Yaowarat; the shopkeepers conducting businesses in Pagoda and Trengganu Street and Yaowarat Road and Charoen Krung Road and members of the temple and foundation hospitals As this is a comparative ... 13 that a comparative analysis can offer us more insight into broader social changes that have taken place in the Singapore case and allow for a more nuanced...
Ngày tải lên : 05/10/2015, 18:58
  • 190
  • 584
  • 0