Characterization of the putative lipase motif of agrobacterium virulence protein virj

Characterization of the putative lipase motif of agrobacterium virulence protein virj

Characterization of the putative lipase motif of agrobacterium virulence protein virj

... aims are to study the interaction of VirJ with other virulence proteins; to examine whether the lipase motif of VirJ would affect the posttranslational modification of the lipoprotein VirB7; and ... acyltransferase motif Mutation of the lipase motif would lead to the malfunctioning of the proteins, indicating that the lipase motif plays a key role...

Ngày tải lên: 03/10/2015, 20:32

113 367 0
Báo cáo y học: "The identification and characterization of a novel protein, c19orf10, in the synovium" docx

Báo cáo y học: "The identification and characterization of a novel protein, c19orf10, in the synovium" docx

... staining (g) Intense staining of a hyperplastic RA synovial lining cell layer This staining was typical of most areas of RA synovium where the lining was hyperplastic (h) An area of an RA synovial ... stained positively (arrow) (e) Intense staining of individual cells in the lining layer of a typical OA synovium (f) An area of an OA synovium demonstrates a lining lay...

Ngày tải lên: 09/08/2014, 10:20

9 490 0
Identification and characterization of agrobacterium tumefaciens vird2 binding protein

Identification and characterization of agrobacterium tumefaciens vird2 binding protein

... Identification and Characterization of a VirD2- binding Protein 80 3.1 Identification of a Novel VirD2- binding Protein 80 3.2 Expression and Purification of Three VBP Proteins 93 3.2.1 Construction of plasmids ... IDENTIFICATION AND CHARACTERIZATION OF AGROBACTERIUM TUMEFACIENS VirD2- BINDING PROTEINS GUO MINLIANG (M Sc.) A THESIS SUBMITTED FOR THE...

Ngày tải lên: 16/09/2015, 15:55

208 257 0
Tài liệu Báo cáo khoa học: Characterization of a chemosensory protein (ASP3c) from honeybee (Apis mellifera L.) as a brood pheromone carrier pdf

Tài liệu Báo cáo khoa học: Characterization of a chemosensory protein (ASP3c) from honeybee (Apis mellifera L.) as a brood pheromone carrier pdf

... brassicae CSPMbraA6 [32] We observed also that BrC15-Ac was able to displace ASA, suggesting that brominated fatty acid and ASA both associated with W81 in the same ligand binding site The ligand ... of heterologous ASP3c in P pastoris MALDI-TOF mass spectrum of recombinant ASP3c (Fig 4) showed a major Fig MALDI-TOF mass spectrometry analysis of the recombinant ASP3c secreted by Pichi...

Ngày tải lên: 21/02/2014, 03:20

11 642 0
Báo cáo khoa học: Molecular cloning and characterization of two soybean protein disulfide isomerases as molecular chaperones for seed storage proteins doc

Báo cáo khoa học: Molecular cloning and characterization of two soybean protein disulfide isomerases as molecular chaperones for seed storage proteins doc

... process of soybean seeds as decreases in the mRNA levels of GmPDIL-1, GmPDIS-1 [26] and GmPDIM [27] were observed during the accumulation of the storage proteins Expression of certain seed storage proteins ... (2008) A novel plant protein disulfide isomerase family homologous to animal P5: molecular cloning and characterization as a functional protein f...

Ngày tải lên: 07/03/2014, 05:20

15 424 0
Cloning, expression and characterization of oxysterol  binding protein homologue 7 (OSH7) in yeast saccharomyces cerevisiae

Cloning, expression and characterization of oxysterol binding protein homologue 7 (OSH7) in yeast saccharomyces cerevisiae

... Oxysterol- binding protein 22 Yeast OSBP homologues 25 1.3.1 Structure of Osh proteins 25 1.3.2 Localization of Osh proteins 27 1.3.3 Function of Osh proteins 27 1.3.3.1 Role of OSH in maintaining ... Deletion of VPS4 causes redistribution of Osh7p 3.2.1 73 77 79 Osh7p-GFP shows different staining pattern in wild-type and vps4∆ strains 3.2.2 71 79 In vivo pro...

Ngày tải lên: 03/10/2015, 20:57

123 381 0
Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx

Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx

... Prm3 was performed using the mutator primers Kin175 (5¢-CACCAGAGCTACTTACA CTGAATTCCAGAATAATCACAAGCAAATC -3 ; sense primer) vs its complement generating pGL3b:Prm3aOCT)1*, pGL3b:Prm3abOCT)1* and ... Prm3aaAP)1*, pGL3e:Prm3aaAP)1*, pGL3b:Prm3aaaAP)1* and pGL3e:Prm3aaaAP)1* Mutation of the Oct-1 element with the sequence aaA TGCa to aaTTCCa (core bases shown in uppercase letters) cen...

Ngày tải lên: 19/02/2014, 16:20

18 509 0
Tài liệu Báo cáo Y học: Identification and characterization of the Escherichia coli stress protein UP12, a putative in vivo substrate of GroEL pptx

Tài liệu Báo cáo Y học: Identification and characterization of the Escherichia coli stress protein UP12, a putative in vivo substrate of GroEL pptx

... lg of protein) were separated by SDS/PAGE using the standard Laemmli system [30] with 13% and 4% (w/w) acrylamide in the separating and stacking gels, respectively In order to estimate the ratio ... they are acidic and presumably located in the cytoplasm like UspA Members of this family share a strikingly similar hydropathy profile (data not shown), and UP12 shares...

Ngày tải lên: 22/02/2014, 07:20

9 548 0
Báo cáo khoa học: Interactions of HIPPI, a molecular partner of Huntingtin interacting protein HIP1, with the specific motif present at the putative promoter sequence of the caspase-1, caspase-8 and caspase-10 genes pdf

Báo cáo khoa học: Interactions of HIPPI, a molecular partner of Huntingtin interacting protein HIP1, with the specific motif present at the putative promoter sequence of the caspase-1, caspase-8 and caspase-10 genes pdf

... Allowing two substitutions Allowing two substitutions Allowing one substitution AAAGACATG AAAGACAGG AAAGAGATT AAAGAGATG AAAGACATA AAAGACATA AAAGAGAAC AAAGACATA AAAGAAAAG AAACAGATG AAAGAAAAG AAAGAAAAG ... EMSA Result Average Kd (nM) AAAGACATG AGAGACATG AAGGACATG AAATACATG AAAGCCATG AAAGAGATG AAAGACCTG AAAGACACG AAAGACATA + ND ND – – + ND ND ND + – – – – + – + – 0.25 1.5 p=0.01 60_HI 60M_HI Fig...

Ngày tải lên: 07/03/2014, 10:20

14 393 0
Báo cáo khoa học: "Characterization of HC58cDNA, a putative cysteine protease from the parasite Haemonchus contortus" pps

Báo cáo khoa học: "Characterization of HC58cDNA, a putative cysteine protease from the parasite Haemonchus contortus" pps

... etis-'3 ehT hcae lµ/loMp 02 fo snoitartnecnoc ni desu erew ]'3-CGAACTTGACCAGGAAAACAA-'5[ 2A dna ]'3-GAGCTATTTCAGAACCGTTT-'5[ 2S ,]'3-TTTAGAA CCTTGGACATAC-'5[ 1A ,]'3-GAGCTATTTCAGAACCG TTT-'5[ ... stluseR etacilpirt ni demrofrep saw sisylana hcaE sknalb retaw evitagen eht rof gnidaer DO eht gnitcartbus yb detaluclac saw ytivitca ehT mn 504 ta daer saw ecnabrosba eht erofeb tsuj setalp eht .....

Ngày tải lên: 07/08/2014, 18:21

7 220 0
Characterization of the GXXXG motif in the first transmembrane segment of Japanese encephalitis virus precursor membrane (prM) protein pot

Characterization of the GXXXG motif in the first transmembrane segment of Japanese encephalitis virus precursor membrane (prM) protein pot

... this article as: Lin et al., Characterization of the GXXXG motif in the first transmembrane segment of Japanese encephalitis virus precursor membrane (prM) protein Journal of Biomedical Science ... protein in the co-infected Sf9 cells Effects of prM proteins with inserted alanine on prM-E heterodimerization in co-infected Sf9 cells To investig...

Ngày tải lên: 10/08/2014, 05:21

14 506 0
Báo cáo y học: "Characterization of N200 and P300: Selected Studies of the Event-Related Potential Salil H. Patel 1 and Pierre N. Azzam 2"

Báo cáo y học: "Characterization of N200 and P300: Selected Studies of the Event-Related Potential Salil H. Patel 1 and Pierre N. Azzam 2"

... months time [10 2] Acute cortical damage to auditory processing structures might be assessed objectively in a complementary manner, via studies of the MMN [10 3] 15 2 10 11 12 13 14 15 16 17 18 Closing ... Shappell SA, Brandt ME Psychophysiology of N200/ N400: A review and classification scheme Advances in Psychophysiology 19 91; 4:43 -10 6 Hoffman JE Event-related pot...

Ngày tải lên: 02/11/2012, 11:08

8 563 0
Characterization of the microbial community in the anaerobic/oxic/anoxic process combine

Characterization of the microbial community in the anaerobic/oxic/anoxic process combine

... and the other was exposed to anoxic conditions (use of nitrogen gas and addition of 20 mg-N/L NaNO3 to the cup) The PUR was estimated from the slope of the line describing the linear decrease in ... facility where the retention time of wastewater in the sewer line is lower than those in the UCT processes In sequencing batch reactors (SBRs), the PURs are hig...

Ngày tải lên: 05/09/2013, 09:38

8 573 4
Characterization of the Carbon Stable Isotope Ratio and Fatty Acid Structure of Zostera japonica in Coastal Areas

Characterization of the Carbon Stable Isotope Ratio and Fatty Acid Structure of Zostera japonica in Coastal Areas

... acid structure in Z japonica We found about 30 kinds of fatty acids in the leaves and stems and about 36 kinds of fatty acids in the roots and rhizomes of Z japonica We focused on the fatty acid ... based on the quantity of lipid, the content ratios of all the fatty acids, and the ratio of each fatty acid RESULTS AND DISCUSSION...

Ngày tải lên: 05/09/2013, 10:17

9 614 2
Preparation and characterization of the PVDF-based composite membrane for direct methanol fuel cells

Preparation and characterization of the PVDF-based composite membrane for direct methanol fuel cells

... PVDF-SPS composite membrane Table shows the water uptake of the pristine PVDF membrane, the PVDF-PS membrane and the PVDF-SPS composite membrane The blending of PS polymer reduces the water uptake of ... of the PVDF-SPS membrane: (a) C1s, (b) O1s, (c) S2p 3.4 Morphology of the PVDF-SPS composite membrane The morphologies of the pristine PVDF...

Ngày tải lên: 05/09/2013, 16:11

14 597 1
w