Characterization of lumpy fill in land reclamation

... problem of finding suitable dumping ground for the disposal of these materials, as well as creating new land for land- scarce Singapore 1.2 Land reclamation in Singapore using Lumpy fill In the ... CHARACTERIZATION OF LUMPY FILL IN LAND RECLAMATION VIJAYAKUMAR ALAPAKAM B.Tech (SVU), M.S.(IIT Madras) A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF ENGINEERIN...

Ngày tải lên: 03/10/2015, 20:32

... residue in the N-terminal part of the peptide that binds in the with the C-terminal domain in CaM However in PhK5 Trp357 is found at the C-terminal end of the peptide This suggests that either PhK5 ... occurring on binding of the peptide and could indicate that the binding of PhK5 to Ca2+⁄ CaM is similar to that observed for Ca2+⁄ CaM binding to i...

Ngày tải lên: 19/02/2014, 17:20

... F1 (ATGGAGAACTCAGT GACCCAAGATGGTAT) and 70b R1 (AGAATTCTGAG GTTGAAGAAGCTAGTAA) primers, and 70b F2 (TACT ATCAGCAGAAGCAATGTGGTGATA) and 70b R2 (TTACTGAGATGTCTTGTTCTTGGAAATGT) primers for atrpa70b ... DNA binding and chromatin association of ATR (ataxia telangiectasia-mutated and Rad3-related) in vitro via ATR interacting protein [4,22,23] Rad17 and Rad9 complexes (Rad17–RFC...

Ngày tải lên: 07/03/2014, 21:20

... percent of available land Of these, 16 are in Africa, in Latin America, in Eastern Europe and Central Asia, and in the rest of the world More strikingly, many of the counties with ample amounts of ... of the large ‘bonanza farms established with the settlement of the northern Great Plains in the US in the late 1800s, virtually all of which were...

Ngày tải lên: 08/03/2014, 10:20

... in the HD -caveolae and LD -caveolae; (c) the VHD -caveolae contained almost a third of the plasma membrane caveolin, and the majority of cellular caveolin is found in the plasma membrane of adipocytes; ... referring to all of them as caveolae, was demonstrated by their content of both caveolin-1 and caveolin-2 The coexistence of caveolin-1 and...

Ngày tải lên: 16/03/2014, 13:20

... as important catalytic residues, indicating a role in binding the nucleotide into the active site [15,16] The crystal structure of CNS from Neisseria meningitidis crystallized in the presence of ... stereo-view of the residues of interest (blue) in the active site of the CNS from Neisseria meningitidis containing CDP (yellow) (PDB 1EYR) [12] su...

Ngày tải lên: 22/03/2014, 21:21

... arginine may affect the secondary structure of the C-terminal tail and the binding of H1.4 to chromatin, as arginine offers additional hydrogen-bonding abilities to DNA as compared to lysine ... cell lines was extracted by using the DneasyTM tissue kit (Qiagen, Hilden, Germany) and examined for sequence variations in codon 18 of H1.2 and in codon 174 of H1.4 To obt...

Ngày tải lên: 30/03/2014, 20:20

... network analysis – to investigate the emergence, structure, and content of translational research in biomedicine by comparing research in cancer and cardiovascular medicine Journal inter-citation is ... sole clinical mix journal in the set, maintains links to both the clinical domain and the molecular biology domain This journal plays a key role linking diverse resear...

Ngày tải lên: 18/06/2014, 19:20

... the measles genotype circulating in China in 2004 and to complement the database of genetic characteristics of China measles strains during the control phase of the disease Table 1: Number of ... [8,27-29] Since WPRO, including China, has recently initiated a program to eliminate measles in 2012, maybe a variety of genotypes will be detected in China as the intensi...

Ngày tải lên: 20/06/2014, 01:20

... network analysis – to investigate the emergence, structure, and content of translational research in biomedicine by comparing research in cancer and cardiovascular medicine Journal inter-citation is ... sole clinical mix journal in the set, maintains links to both the clinical domain and the molecular biology domain This journal plays a key role linking diverse resear...

Ngày tải lên: 20/06/2014, 03:20

... processing She has published a number of proceedings papers and papers on medical image processing and tissue characterization Automatic Characterization of Myocardial Perfusion in Contrast Enhanced ... the intensity of the CM In our opinion, the use of 3D analysis of myocardial perfusion MRI in clinical environment requires both an improvement in MR device...

Ngày tải lên: 23/06/2014, 01:20

... 22 Mobile Robots - State of the Art in Land, Sea, Air, and Collaborative Missions 6.1 Standards and architecture In the last century, the manufacturing industry has benefited enormously from the ... abilities of a cockroach It consists of binocular vision system based on infrared 20 Mobile Robots - State of the Art in Land, Sea...

Ngày tải lên: 27/06/2014, 00:20

... diester-P in the clay and silt fractions from mineralization and explain the higher diester proportion observed in VR and NF soils than in SM and FG (table IV) with higher amounts of these fine fractions ... these forest soils that an increase of the rainfall causes a decrease of the quality of SOM as a consequence of decreasing the pH and increasing of free...

Ngày tải lên: 08/08/2014, 14:21

... distribution of the inorganic phosphate (Pi) and glucose transporter in the brain of normal and MPTPintoxicated mice Pi and glucose represent key molecules in cellular energy metabolism The mitochondrion ... characterization of energy metabolism in the brain of normal and MPTP-intoxicated mice using new markers of glucose...

Ngày tải lên: 10/08/2014, 05:21

... Page of 15 Figure Expression profiles of Actinidia flowering genes in mature plant organs Real-time RT-PCR analysis of the Actinidia flowering genes in the root, stem internode, leaf, flower and ... Figure Expression profiles of Actinidia flowering genes in normal and aberrant flowers Real-time RT-PCR analysis of the Actinidia flowering genes in the lea...

Ngày tải lên: 11/08/2014, 11:22