HDAC INHIBITOR TARGETED THERAPY WITH NANOMEDICINE INCREASES THE EFFICACY OF PACLITAXEL IN TRIPLE NEGATIVE BREAST CANCER

... efficacy in breast cancer models, which would have more impact in the field of triple negative breast cancer Treatment combining epigenetics and anti-mitotic targeted therapies could improve the therapeutic ... the TNBC cells to certain cisplatin and PARP inhibitor treatment (Bhalla et al., 2012) Thus, it would be interesting to further explore the therapeutic...

Ngày tải lên: 01/10/2015, 17:28

... Chemotherapy The most active chemotherapy agents in ovarian cancer are the platinum analogues, cisplatin and carboplatin The antitumor activity of cisplatin (cis-diamminedichloroplatinum (II)) was ... platinum-sensitive human ovarian cancer cell line OVCAR They also appeared to slow the growth of the cisplatin- sensitive human ovarian cancer cells GG and JAM [...

Ngày tải lên: 20/06/2014, 07:20

... irinotecan/carboplatin with or without cetuximab in patients with metastatic breast cancer Breast Cancer Res Treat 2007, 106:S32-S33 Carey LA, O’Shaughnessy JA, Hoadley K, Khambata-Ford S, Horak CE, ... expression profiling study of 99 patients with breast cancer, 41 of whom had triple negative disease They noticed that nine of the patients with TNBC clustered together wi...

Ngày tải lên: 10/08/2014, 22:21

... will compare the efficacy of topiramate with placebo in the treatment of PTSD, and will study its tolerability through the drop out rate in each group The primary hypothesis is that topiramate ... superior to placebo in the treatment of PTSD Secondary research goals includes studying the efficacy of topiramate in social adjustment, functioning and q...

Ngày tải lên: 11/08/2014, 17:20

... reorganization of the actin filament system, playing a role in the migration of endothelial cells and in recovery of cells from wounding [40] In a variety of cells, in addition to the induction of hsp25 and ... MG132 and the reprogramming of translation (Eur J Biochem 271) 3605 A B C Fig Inhibition of p38MAP kinase activity attenuates the induction...

Ngày tải lên: 23/03/2014, 12:20

... Secondary infection with Streptococcus suis serotype increases the virulence of highly pathogenic porcine reproductive and respiratory syndrome virus in pigs Virology Journal 2010 7: 184 Submit your ... Li Y, Wang X, Bo K, Tang B, Yang B, Jiang W, Jiang P: Emergence of a highly pathogenic porcine reproductive and respiratory syndrome vi...

Ngày tải lên: 12/08/2014, 04:20

... Evaluating the efficacy of sequential biologic therapies for rheumatoid arthritis patients with an inadequate response to tumor necrosis factor-a inhibitors Arthritis Research & Therapy 2011 13:R25 ... TA, Uffmann M, Smolen JS: Benefit of very early referral and very early therapy with disease-modifying antirheumatic drugs in patients with early...

Ngày tải lên: 12/08/2014, 15:22

... history with consequent exclusion of these five patients would lead to an increased specificity of 99.5% at the manufacturer’s threshold Analysis of test criteria To further assess the performance ... significantly better than the anti-dsDNA ELISA (p = 0.0024 and p = 0.0029, respectively) The Farr assay was not significantly better than any other ELISA, nor was the o...

Ngày tải lên: 12/08/2014, 15:22

... al.: The association between systemic glucocorticoid therapy and the risk of infection in patients with rheumatoid arthritis: systematic review and meta-analyses Arthritis Research & Therapy 2011 ... literature review and meta-analysis (where appropriate) of RCTs and observational studies to assess the association between systemic GC th...

Ngày tải lên: 12/08/2014, 17:22

... 2.1 Ha Trung high school and current situation of teaching and learning English at the school 2.1.1 Ha Trung high school 10 Ha Trung high school is one of the leading schools in Thanh Hoa province ... deals with the theories of the role of grammar, students’ motivation, and the application of games in teaching grammar It is impo...

Ngày tải lên: 07/11/2012, 14:44

... in Interbrand’s ranking of the leading luxury brands of 2008 (Interbrand 2009) In addition, they are rated #2 and #3, respectively, on the Luxury Institute’s list of the most familiar luxury handbag ... larger sample of non-patricians with the hope of insuring we had significant representation from each of the three other classes of consumers The zip codes, a...

Ngày tải lên: 18/02/2014, 21:20

... (2009) ranking of the leading luxury brands of 2008, and they are rated second and third, respectively, on the Luxury Institute’s list of the most familiar luxury handbag brands (see www.luxuryinstitute.com) ... sample of nonpatricians with the hope of ensuring a significant representation from each of the three other classes of consumers The zip codes, along...

Ngày tải lên: 19/02/2014, 03:20

... The role of the C-terminal domain on Hfq (Eur J Biochem 271) 1259 the model further confirmed by determination of the X-ray structure of Staphylococcus aureus and E coli Hfq proteins [19,20] Hfq ... binding of the polyadenylated rpsO RNA We have shown that the presence of the remainder of the acidic tail results in the thermodynamic stabilization of...

Ngày tải lên: 19/02/2014, 12:20

... GLU R1 5A forward (5¢-ATTCAAACTATAAAGTTGACGCAA CTGACTTGGAAACCTTC-3¢), GLU R1 5A reverse (5¢GAAGGTTTCCAAGTCAGTTGCGTCAACTTTATAGTT TGAAT-3¢); GLU H44 7A forward (5¢- GCAAGTCATTT TGGATGCTATTAATGATGATGGCTC-3¢), ... form any additional contacts with the molecule A 2164 Catalytic site The catalytic reaction of glucoamylases proceeds with inversion of configuration at the anom...

Ngày tải lên: 07/03/2014, 12:20