Korea and korean studies from asian vision

... Asse$sment and prospects Prof Lin, Ming-teh: Today and tomorrow of Korean studies in Ta iwan Mr Duong Chinh Thuc: Korea and Korean Studies from the vision of Vietnam - Korea relationship Dinner (Asian ... Philippines: Assessment and prospects 163 Mr Duong Chinh Thuc Korea and Korean Studies from the vision of Vietnam - Korea relationship 164 Do Kim Thanh...

Ngày tải lên: 30/09/2015, 17:20

... Ballard, J A ed 1981 Policy- Making in a New State: Papua New Guinea 1972–77 St Lucia: University of Queensland Press Policy Making and Implementation: Studies from Papua New Guinea Barzelay, M with ... Social and Environmental Studies Division of the Papua New Guinea National Research Institute ix Policy Making and Implementation: Studies...

Ngày tải lên: 22/03/2014, 21:20

... domain Because WD40 domain is involved in mediating protein–protein interactions, the LRRK2 G2385R variant may impact on interactions with substrates and ⁄ or regulatory proteins Preliminary studies ... Genetic and clinical studies of LRRK2 U Kumari and E K Tan cal hallmarks are characterized by a progressive and profound loss of neuromelanin-containing dopaminergic neur...

Ngày tải lên: 23/03/2014, 04:20

... to total concentrations of multiple indoor air pollutants It is used as a complementary indicator to decrease indoor pollution level in total and achieve healthy indoor air environment. 109) The ... determination and the comparison of their value Indoor Environ., 11, 1–9 (in Japanese) Fukutomi, Y., Yasuda, H., Nakazawa, T., Taniguchi, M and Akiyama, K (20...

Ngày tải lên: 17/02/2014, 22:20

... template using Deep Vent DNA polymerase (New England Biolabs, Ipswich, MA, USA), a sense primer (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG ... Salmonella typhimurium SurE A Pappachan et al phase and under conditions of high temperature and high salt compared with parent strains that had the intact surE gene [1] Th...

Ngày tải lên: 18/02/2014, 14:20

... inactivation of c-aminobutyric acid transaminase by gabaculine and more recently by others for the inactivation of c-aminobutyric acid transaminase [32], d-amino acid aminotransferase [33], and ... various AdoMet and KAPA concentrations n 20 lM KAPA; h 50 lM KAPA; d 70 lM KAPA; s 100 lM KAPA; r 140 lM KAPA (B) Replot of the ordinate intercepts against KAPA concentrations Data we...

Ngày tải lên: 07/03/2014, 11:20

... uorescence studies of conformational changes induced by cyclic AMP and DNA binding to cyclic AMP receptor protein from Escherichia coli Eur J Biochem 270, 14131423 Yu S & Lee JC (2004) Role of residue ... changes induced by DNA and cAMP 19 20 21 22 23 24 25 26 27 28 29 30 31 cAMP -induced allosteric changes in T127I, S128A and T127I S128A mut...

Ngày tải lên: 07/03/2014, 16:20

... Tyr158, Glu2 12, Arg215 and Trp246 in ricin) and another ve conserved residues (Asn 72, Arg 124 , Gln160, Glu195 and Asn196 in abrin -a and abrin-c and Asn78, Arg134, Gln1 72, Glu208 and Asn209 in ricin) ... Journal 27 2 (20 05) 120 1 121 0 ê 20 05 FEBS 120 3 Pulchellin A- chain: cloning and structural studies A A L C Silva et al B C Fig (A) A- chain expression anal...

Ngày tải lên: 07/03/2014, 16:20

... Studies on the mycobacterial P450mor system B Sielaff and J R Andreesen the encoding operon revealed also the gene encoding the specific reductase, which is required for activity of the P450mor ... about the binding properties of the active site of P450mor and the permitted access of molecules to it, the binding of different azole compounds to the heme group of...

Ngày tải lên: 07/03/2014, 16:20

... rans phil us Vibrio cholerae Escherichia coli Rickettsia prowazekii Sulfolobus acidocaldarius Aquifex aeolicus Helicobacter pylori B ac Prokaryotic Family I sPPases * Neisseria meningitidis 925 ... (MDLSRIPPQP KAGILNVLIE IPAG), and Rhodop viridis (MRIDA IDXA), and that of Mi aeruginosa NIES-44 (MDL SRKPAQP IPGLKNVLVE TAGSINIT) [16], show a high degree of similarity with other cyto...

Ngày tải lên: 16/03/2014, 11:20

... Part of a two-dimensional 1H,13C HSQC spectrum of the O-specific polysaccharide (OPS) of Citrobacter braakii PCM 1531 One-dimensional 1H and 13C NMR spectra are displayed along the horizontal and ... immunodiffusion of anti (Citrobacter braakii PCM 1531) serum (A) and anti- (Citrobacter PCM 1487) serum (B) with lipopolysaccharide (LPS)-I (well 1) and...

Ngày tải lên: 23/03/2014, 17:22

... of two case studies Generating with Unification Grammars The goal of employing a single, minimally augmented, grammar for both parsing and generation has become more accessible with the introduction ... successfully in general, mJking it possible to envisage defining the 'adequacy' of a grammar in terms of its behavior both in parsing and in generation References...

Ngày tải lên: 24/03/2014, 02:20

... Dioxin from Pulp and Paper and Lead in Soil at Mining Sites i Abstract This paper discusses EPA’s acquisition and use of science in addressing dioxins (and other organochlorines) from the pulp and ... contaminated soil to be excessive Dioxin from Pulp and Paper and Lead in Soil at Mining Sites ii Abstract Table of Cont...

Ngày tải lên: 24/03/2014, 05:20

... Economic Education National Endowment for Financial Education National Foundation for Consumer Credit National Futures Association National Institute for Consumer Education National Institute for ... is and how risk fits in with their long- and short-term financial goals And They Need to Understand Their Retirement Options In the Savings Are Vital to Everyone’s Ret...

Ngày tải lên: 29/03/2014, 08:20

... kDa, a second peak of 30 kDa and a third peak of about 20 kDa A similar gel filtration experiment was also carried out for the complex of XAIP with a- amylase A mixture of XAIP and a- amylase was ... observations indicate that XAIP associates with GH11 xylanase and GH13 a- amylase, as well as with both xylanase and a- amylase simultaneously Tissue distribution...

Ngày tải lên: 29/03/2014, 09:20