Atomic number dependence of spin hall effect

... precession in spin transport 24 1.3 Objective and scope of this thesis 25 1.3.1 Atomic number dependence on spin Hall effect 25 Experimental techniques 27 2.1 ... relaxation length with coherent spin transport up to hundreds of micron [2][3] In this thesis, we study the possibility of manipulating electron spins in graphene via spin Hall effect (SHE) through meta...

Ngày tải lên: 30/09/2015, 10:11

... positive for the case of D = 100 nm III.2 Dependence of the Casimir force on direction of magnetic field To study the influence of the direction on the magnetic field on the Casimir effect, we changed ... change of sign happens, we present in Fig.4a, MAGNETIC FIELD DEPENDENCE OF MAGNETIC CASIMIR EFFECT 287 Fig Magnetic Casimir energy between the plat...

Ngày tải lên: 30/10/2015, 20:53

... presence of a small external field For the ZFC data, the magnetic moment rises more rapidly and attains a greater maximum value for the field applied parallel to the film surface This implies an easy magnetization ... qualitative agreement with the theoretical model of the ZFC magnetization of weakly interacting nanoparticle assemblies proposed by Azeggagh and Kachkachi [31...

Ngày tải lên: 21/06/2014, 17:20

... study the electron-spin dynamics in dependence of the orientation (h) of the magnetic field The spin precession frequency, amplitude, and decay rate as a function of h are estimated and their dependences ... electron spin and rapidly relaxing spin of the hole Since gk and g\ are close in magnitude, the contribution from a difference in the spread of thei...

Ngày tải lên: 22/06/2014, 00:20

... have studied the Hall effect in quantum wells with parabolic potential subjected to a crossed dc electric and magnetic fields in the presence of a strong EMW (laser radiation) The electron - acoustic ... optical phonon interaction has been taken into account and the influence of a strong EMW has been considered in details To make a compariso...

Ngày tải lên: 31/10/2015, 10:41

... Purification and refolding of N-terminal His-tagged gAd-GLP-1-A fusion protein The fusion protein was purified by High-Affinity Ni-IDA Resin After filtering, the fusion protein was bound in the column ... by improving both insulin resistance and insulin secretion deficiency However, we only observed the glucose-lowering effect of the whole fusion protein in thi...

Ngày tải lên: 25/10/2012, 11:10

... Films and Boundary Lubrication • Nanocontacts • Quartz Microbalance Experiments in Tribology 6.4 Modeling of an SFFM Resolution in SFFM • Deformation of Tip and Sample • Modeling of SFM and SFFM: ... Akamine et al., 1990; Wolter et al., 1991) and, on the other hand, to new detection schemes, in particular to the optical beam deflection method (Meyer and Amer, 1988, 1...

Ngày tải lên: 25/12/2013, 23:18

Ngày tải lên: 12/01/2014, 22:06

... the anion protein interactions in A-state stabilization Competition among anions To better define the effect produced by monovalent anions on the sulfate-induced A-state of cytochrome c, we monitored ... environment of the sulfate-induced A-state of cytochrome c, as observed from changes induced in the 416 nm Cotton effect (sulfate concentration: 50 mM) The e...

Ngày tải lên: 19/02/2014, 05:20

... to avoid the formation of hairpin or slipped duplex structures and to limit the base pair length less than 12 bp For any of the non-self-complementary duplex formations, the thermodynamic parameters ... DNA/DNA and 41 RNA/DNA duplexes at standard temperature (25 C) and physiological temperature (37 C) Direct comparison shows that the temperature- independent and...

Ngày tải lên: 22/02/2014, 07:20

... Correlation effects in atomic thermal vibration of fcc crystals 27 The purpose of this work is to study the correlation effects in atomic vibrations of fcc crystals in XAFS, i.e., to develop ... vibrate under influence of the neighboring environment Taking into account the influences of the nearest atomic neighbors the Einstein effective interaction poten...

Ngày tải lên: 05/03/2014, 14:20

... Isotope effects and their pH dependence in MAO A pH pH Fig (A, B) pH dependence of the steadystate kinetic parameters of MAO A- catalysed oxidation of kynuramine at 20 °C (C, D) pH dependence of the ... steady-state kinetic parameters of MAO A- catalysed oxidation of benzylamine at 20 °C Fig S2 pH dependence of the reductive half-reaction o...

Ngày tải lên: 07/03/2014, 06:20

... CACACTGCAACCTCTGGT ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC TTAGTTACCGTGTGCTTC ... TTAGTTACCGTGTGCTTC CACCGAGGAATAATAAATGATG AACGCACAAAAATCA TTACATTTTCACTTTAGT OMCA- PBAD-R OMCB- PBAD-F OMCB- PBAD-R 3736 controlled by an arabinose promoter [26], was achieved...

Ngày tải lên: 07/03/2014, 09:20

... a t is, if the training and test sets are extracted from the same corpus, they will probably contain the same kind of errors in the same kind of situations This may cause the training procedure ... uncertainty in the evaluation m a y be, in some cases, larger than the reported improvements from one system to another, so invalidating the conclusions of the co...

Ngày tải lên: 08/03/2014, 05:21

... the temperature dependence of the morphology of SiNWs synthesized by laser ablation In this Letter, we present the results on this project Our results show that the morphology and diameter of ... B, the temperature dependence of the morphology and diameter of the SiNWs is similar to that by thermal evaporation, reported recently by Peng et al [14] I...

Ngày tải lên: 16/03/2014, 15:09