Development of reduced models for proton exchange membrane fuel cells
Development of reduced models for proton exchange membrane fuel cells
... now 1.2 Types of Fuel Cells There are six types of fuel cells that are currently in commercial use, di¤erentiated according to the type of electrolyte: Proton Exchange Membrane Fuel Cell (PEMFC), ... Methanol Fuel Cell (DMFC), Alkaline Fuel Cell (AFC), 1.2 Types of Fuel Cells Phosphoric Acid Fuel Cell (PAFC), Molten Carbonate Fuel Cell (MCFC), Solid Oxide...
Ngày tải lên: 30/09/2015, 06:29
Integrated platinum carbon nanotube based electrocatalyst for high efficiency proton exchange membrane fuel cells 1
... Suitable for all sizes of power stations, kW to multi-MW Table 1. 1 Main types of fuel cells and their characteristics and applications 1. 3 Proton Exchange Membrane Fuel Cells (PEMFCs) Proton Exchange ... 1- 1 to 1- 3 [2]: Anode: H2 2H+ + 2e- Cathode: 2H+ + 2e- + 1/ 2O2 Overall: H2 + 1/ 2O2 (1- 1) H2O H2O + electricity + heat (1- 2) (1- 3) According to Eq 1- 3, t...
Ngày tải lên: 11/09/2015, 10:02
Integrated platinum carbon nanotube based electrocatalyst for high efficiency proton exchange membrane fuel cells 2
... most accurate and realistic information of the Pt/CNT -based electrocatalyst as a potential substitute for conventional Pt/VXC72Rbased electrocatalysts used for high- efficiency PEMFC applications ... VCXC72R Carbon paper TGPH090 Toray Carbon black (CB) VCXC72R Cabot Commercial Pt catalyst 40wt% Pt/VCXC72R Johnson Matthey Commercial Pt catalyst 20 wt% Pt/VCXC72R E-TEK Nafion m...
Ngày tải lên: 11/09/2015, 10:03
Integrated platinum carbon nanotube based electrocatalyst for high efficiency proton exchange membrane fuel cells 3
... (6vol%) and silane (1vol%) solution containing 0 .3 M Ni(NO3)2 and 0 .3 M Co(NO3)2 for h During the CNT growth, the carbon paper was heated at 600 °C for at 35 0 sccm Ar and 1.5 sccm H2 flow to obtain ... well as the carbon graphitization (see Fig 3. 2 (a)) On the other hand, at a high growth temperature of 800 °C, thermal pyrolysis of C2H4 would take place to form amorphous ca...
Ngày tải lên: 11/09/2015, 10:03
Integrated platinum carbon nanotube based electrocatalyst for high efficiency proton exchange membrane fuel cells 4
... studies [13-17] 20000 4f7/2, 71.1 eV 4f5/2, 74. 4 eV 16000 CPS 12000 8000 40 00 84 82 80 78 76 74 72 70 68 66 64 Binding energy / eV Fig 4. 4 XPS spectrum of Pt nanoparticles on CNT /carbon paper by sputter-deposition ... sccm C2H4) 0.8 Pt/CNT -based cathode (15 sccm C2H4) Cell potential / V Pt/CNT -based cathode (20 sccm C2H4) Pt/CNT -based cathode (25 sccm C2H4) 0.6 -2 Pt loading:...
Ngày tải lên: 11/09/2015, 10:03
Integrated platinum carbon nanotube based electrocatalyst for high efficiency proton exchange membrane fuel cells 5
... The longterm stability information of Pt/CNT -based electrocatalysts from a fuel cell under real operating conditions would be very useful for the full evaluation of these electrocatalysts in terms ... wt% Pt/VXC72Rbased electrodes at 1 .5 V vs DHE 141 120 (a) Before potentiostatic oxidation After 30min oxidation at 1.5V After 60min oxidation at 1.5V After 90min oxidation at 1.5V A...
Ngày tải lên: 11/09/2015, 10:03
Integrated platinum carbon nanotube based electrocatalyst for high efficiency proton exchange membrane fuel cells 6
... cm-1 This technique is thus more suitable for fabricating low Pt loading electrode with high Pt utilization for PEMFC applications 6. 2 Recommendations for Future Research The in situ grown CNT ... tests were performed in a single cell test system When compared with two commercial Pt/VXC72R -based electrodes, the Pt/CNT -based electrode showed a notable improvement in polarization...
Ngày tải lên: 11/09/2015, 10:03
Development a new equation of polarization curve for a proton exchange membrane fuel cell at different channel geometry
... reaction at the surface of catalyst layers ● A new correlation for predicting the polarization curve of a PEM fuel cell according to cell temperature and the parameter of cross-section channel geometry ... (7) that in this equation current density is in A/ cm2, temperatures are in ºC and Z=1 for elliptical channel and Z=2 for triangular channel and Z=3...
Ngày tải lên: 09/09/2015, 10:32
Mass transport enhancement in a proton exchange membrane fuel cell
... water and proton transport in catalyst layer and membrane, as well as electrical current transport in the bipolar plate The generalized Stefan-Maxwell equation is used to model the water and proton ... channels (parallel, serpentine, inter-digitated and etc) are machined in graphite plates to feed the reactant gases to the GDL Optimum flow channel area can be determined, as in...
Ngày tải lên: 14/09/2015, 08:36
Tài liệu Báo cáo " Development of system of HydrodynamicEnvironmental models for coastal area (Case study in Quang Ninh - Hai Phong region) " doc
... d) after 12 days in Ha Long Bay area: a, b - SE wind, c, d - NE wind Development of system of hydrodynamic-environmental models for coastal area 65 The field sampling results in September 2005 ... 1/2003, pp 10 8-1 13 (in Vietnamese) [7] Dinh Van Uu et al (2005), Application of the 3D water circulation model for studying SPM transport processes in Quang...
Ngày tải lên: 13/02/2014, 12:20
Development of DMC controllers for temperature control of a room deploying the displacement ventilation HVAC system
... develop a controller for temperature control inside a room within a desired band of temperatures for comfort The details of the geometry of the room and the HVAC system based on displacement ventilation ... disadvantages of the DMC controller First, the DMC controller is a local controller which can only guarantee the stability of the...
Ngày tải lên: 05/09/2013, 16:11
Tài liệu The Development of the Feeling for Nature in the Middle Ages and Modern Times doc
... out of the earth 'And wine that maketh glad the heart of man The Development of the Feeling for Nature in the Middle Ages and Modern Times 'The trees of the Lord are full of sap; the cedars of ... life, of mind, mood, and feeling, The Development of the Feeling for Nature in the Middle Ages and Modern Times which...
Ngày tải lên: 21/02/2014, 20:20
Tài liệu Báo cáo khoa học: "Web augmentation of language models for continuous speech recognition of SMS text messages" docx
... empirical study of smoothing techniques for language modeling Computer Speech and Language, 13:359–394 Joshua T Goodman 2001 A bit of progress in language modeling Computer Speech and Language, 15:403–434 ... N-gram language models are then trained separately on the in-domain text and the the filtered web text If the amount of web text is very large, only a subset i...
Ngày tải lên: 22/02/2014, 02:20
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx
... used for RT-PCR were: for the I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCT AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC ... recombination introducing the c-myc-OR17-40 coding sequence, using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢) and (5¢-G...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo khoa học: " The Development of Lexical Resources for Information Extraction from Text Combining Word Net and Dewey Decimal Classification" potx
... ambiguity in WordNet by combining its information with another source of information: the Dewey Decimal Classification (DDC) (Dewey, 1989) Reducing the lexical ambiguity in W o r d N e t The main ... greatly reduce the ambiguity implied by the use of WordNet by finding the correct set of field labels that cover all the WordNet hierarchy in an uniform way Therefo...
Ngày tải lên: 08/03/2014, 21:20