MiR 122 targets pyruvate kinase m2 and affects metabolism of hepatocellular carcinoma

... Issue | e86872 miR- 122 Affects HCC Metabolism through PKM2 of PKM2 after transfection of PKM2 expression plasmid (PKM2) (D) The reduction of lactate content upon transfection of miR- 122 expression ... e86872 miR- 122 Affects HCC Metabolism through PKM2 PLOS ONE | www.plosone.org January 2014 | Volume | Issue | e86872 miR- 122 Affects HCC Metabolism through PK...

Ngày tải lên: 23/09/2015, 14:47

... were obtained with p300 mRNA expression examined by RT-PCR and p300 protein expression by Western blotting in liver tissues In this study, the status of expression of p300 mRNA and p300 protein ... staining of p300 High expression of p300 could be detected in 60/123 (48.8%) of HCCs, in 6/87 (6.9%) of adjacent liver tissues with cirrhosis and in 2/36...

Ngày tải lên: 18/06/2014, 16:20

... hypoxia and reoxygenation have been reported to induce DNA damage [30–32], we examined the effects of pyruvate addition during hypoxia and after reoxygenation on DNA damage HepG2 cells were incubated ... by Singh et al [48], using alkaline electrophoresis, which allows detection of single-strand and double-strand breaks Pyruvate reduces DNA damage during...

Ngày tải lên: 18/02/2014, 16:20

... characterization of Utp25p as a novel nucleolar protein required for efficient cleavage of 35S pre-rRNA at sites A0 , A1 and A2 Depletion of Utp25p causes the accumulation of the pre-rRNA 35S and the aberrant ... 5¢-GGATCCATGGGC AAACGCGGGAGCC-3¢ and 5¢-ATCGATGTCGACTCA TTTTTCTCCAGTAATGAAGAG-3¢ The gene was cloned in fusion with yEGFP3 using BamHI and Sal...

Ngày tải lên: 22/03/2014, 21:21

... al.: Characterization and targeting of phosphatidylinositol-3 kinase (PI3K) and mammalian target of rapamycin (mTOR) in renal cell cancer Journal of Translational Medicine 2011 9:133 Submit your ... factor; mTOR: Mammalian target of Rapamycin; PI3K: phospahtidylinositol-3 kinase; RCC: renal cell carcinoma; RTK: receptor tyrosine kinase; and T...

Ngày tải lên: 18/06/2014, 22:20

... Elfiky et al.: Characterization and targeting of phosphatidylinositol-3 kinase (PI3K) and mammalian target of rapamycin (mTOR) in renal cell cancer Journal of Translational Medicine 2011 9:133 ... factor; mTOR: Mammalian target of Rapamycin; PI3K: phospahtidylinositol-3 kinase; RCC: renal cell carcinoma; RTK: receptor tyrosine kinase; and T...

Ngày tải lên: 20/06/2014, 04:20

... hydroxyl-radical scavenging and a novel, glutathione-sparing mechanism of action Arch Biochem Biophys 2000, 381:253-263 de la Lastra CA, Villegas I: Resveratrol as an anti-inflammatory and anti-aging agent: ... Sclafani RA, Agarwal R: Resveratrol causes Cdc2-tyr15 phosphorylation via ATM/ ATR-Chk1/2-Cdc25C pathway as a central mechanism for S phase arrest in human ovarian carcinoma...

Ngày tải lên: 18/06/2014, 15:20

... al.: More expressions of BDNF and TrkB in multiple hepatocellular carcinoma and anti -BDNF or K252a induced apoptosis, supressed invasion of HepG2 and HCCLM3 cells Journal of Experimental & Clinical ... neutralizing antibody specific for BDNF or Trk tyrosine kinase inhibitor K252a against TrkB probably antagonized the protection of BDNF/...

Ngày tải lên: 10/08/2014, 10:21

... Cite this article as: Zekri et al.: Serum levels of soluble Fas, soluble tumor necrosis factor -receptor II, interleukin-2 receptor and interleukin8 as early predictors of hepatocellular carcinoma ... HCC cases indicating that sFas may function as an inhibitor of the Fas/Fas-L system and escape of tumor cells from immune surveillance may then...

Ngày tải lên: 13/08/2014, 13:20

... between AST level and overexpression of Tyro3 32 Table Correlation between Tyro3 overexpression and ALT level 33 Table Correlation between tumor size and overexpression of Tyro3 34 Table ... of Tyro3 expression with AST level 32 4.2.4 Correlation of ALT level with overexpression of Tyro3 33 4.2.5 Correlation between Tyro3 overexpression and tumor size 3...

Ngày tải lên: 13/10/2015, 15:55

... factor in the control of the affinity for Na+ and K+ in pyruvate kinase Selectivity of pyruvate kinase for Na+ and K+ (Eur J Biochem 270) 2383 Ó FEBS 2003 Table Transfer energies for K+ and Na+ ... Solvation and energetic of binding of Na+ and K+ to pyruvate kinase It has been hypothesized [18] that the difference between Na+ and K...

Ngày tải lên: 08/03/2014, 02:20

... p-eIF4E [10] in AD brains In the current study (Table 1), levels of total and p-forms of mTOR, 4E-BP1, eEF2, and eEF2K were investigated in relationship with tau in homogenates of the medial ... correlation with tau nonphosphorylated at Tau1 sites Total and phosphorylated levels of eEF2K and eEF2 in AD and control brains Levels of p-eEF2K w...

Ngày tải lên: 16/03/2014, 22:20

... receptor tyrosine kinase activity [4], and the finding of EGFR, the first receptor tyrosine kinase paved the way to the understanding of the role and significance of tyrosine kinase in cancer ... tyrosine kinase inhibitors Inhibiting the activity of tyrosine kinases by low molecular weight compounds capable of interfering with either ligand binding (in the case of receptor...

Ngày tải lên: 03/11/2012, 09:57

... UMPK The F133N mutation was created using UMP kinase from Ureaplasma parvum the following primers: F133N-fw (5¢-GATTTTTGTGGCT GGAACAGGAAACCCATATTTTACAACTGATTCG) and F133N-rv (5¢-CGAATCAGTTGTAAAATATGGGT ... with ADP and UDP, and ADP showed a rate that was > 20 times that of UDP In order to determine the true Km for UMP and ATP, a two-substrate assay was performed at fou...

Ngày tải lên: 18/02/2014, 16:20

... strain was grown in media lacking leucine The other strains were grown in media containing leucine Complementing abilities of LEU2, UTR1 and YEF1 for the growth defects of the pos5 mutant To confirm ... using recombinant protein expressed in E coli We also confirmed that Utr1p, initially identified as an ATP-NAD kinase [1], was in fact an ATP-NADH kinase Thus, the three is...

Ngày tải lên: 20/02/2014, 01:20