optimized rtpcr assay for the detection of infectious myonecrosis virus (imnv)

optimized rtpcr assay for the detection of infectious myonecrosis virus (imnv)

optimized rtpcr assay for the detection of infectious myonecrosis virus (imnv)

... of RT-PCR assay for the detection of IMNV 21 Figure 4.2: Result of 2st step of RT-PCR assay for the detection of IMNV 22 Figure 4.3: Result of 2st step of RT-PCR assay for the detection of ... COLLEGE OF AQUACULTURE AND FISHERIES OPTIMIZED RT-PCR ASSAY FOR THE DETECTION OF INFECTIOUS MYONECROSIS VIRUS (IMNV) By NGUYEN KHANH LINH...

Ngày tải lên: 22/09/2015, 17:04

46 199 0
Genotoxicity of 255 chemicals in the Salmonella microsome test (Ames test) and 8-hydroxyguanine (8-OH-Gua) assay for the detection of carcinogens

Genotoxicity of 255 chemicals in the Salmonella microsome test (Ames test) and 8-hydroxyguanine (8-OH-Gua) assay for the detection of carcinogens

... Identification of C8-modified deoxyinosine and N2- and C8-modified deoxyguanosine as major products of the in vivo reaction of N-hydroxy-6-aminochrysene with DNA and the formation of the adducts in isolated ... recommend the Ames test using these sensitive strains (especially YG1041 and/ or YG1042) in combination with the standard tester strains (TA98 and TA...

Ngày tải lên: 05/09/2013, 08:40

6 735 0
Báo cáo sinh học: " Development of a real-time QPCR assay for the detection of RV2 lineage-specific rhadinoviruses in macaques and baboons" docx

Báo cáo sinh học: " Development of a real-time QPCR assay for the detection of RV2 lineage-specific rhadinoviruses in macaques and baboons" docx

... 5'-CCGTAGGCGATGGTCGTCCTAACRAAYTGNGG-3' 5'-TACAAAATACAGCGAGTGATANATRAARCA-3' ORF 59 (RFHV/KSHV)7 5'-TGAAAATCCACAGGCATGAT-3' 1The terminal "a" or "b" in the primer name indicates the plus or minus sense of the gene transcription, ... at the WaNPRC DNA samples were obtained from PBMC of a random assortment of thirty macaques housed at the WaNPRC and analyzed using the...

Ngày tải lên: 18/06/2014, 22:20

12 510 0
báo cáo hóa học:" Development of a real-time QPCR assay for the detection of RV2 lineage-specific rhadinoviruses in macaques and baboons" pot

báo cáo hóa học:" Development of a real-time QPCR assay for the detection of RV2 lineage-specific rhadinoviruses in macaques and baboons" pot

... at the WaNPRC DNA samples were obtained from PBMC of a random assortment of thirty macaques housed at the WaNPRC and analyzed using the standard RV2 and OSM QPCR assays While all of the samples ... 5'-CTTGCCAACGATTACATTTCCAGRGAYGARCT-3' 5' CTGGCTAACGACTACATCTCCAGRGAYGARCT-3' 5'-GGCAGTTTCAAGGCTGTGAATTTYTTYGARCG-3' 5'-CCGTAAGAAATGGTGGTCCTGACRAAYTGNGG-3' 5'-CCGTAGGCGATG...

Ngày tải lên: 20/06/2014, 04:20

12 471 0
Báo cáo khoa học: " A biosensor assay for the detection of Mycobacterium avium subsp. paratuberculosis in fecal samples" potx

Báo cáo khoa học: " A biosensor assay for the detection of Mycobacterium avium subsp. paratuberculosis in fecal samples" potx

... biosensor assay for the detection of Mycobacterium avium subsp paratuberculosis in fecal samples incubated for 20 at room temperature The membranes were dried for an additional 1.5 h in a vacuum ... increased as the concentration of the target sample increased Assays were run in triplicate The value for the negative control was 1.04 ± a value o...

Ngày tải lên: 07/08/2014, 23:22

8 385 0
Báo cáo y học: "Comparative study between the Hybrid Capture II test and PCR based assay for the detection of human papillomavirus DNA in oral submucous fibrosis and oral squamous cell carcinoma" pdf

Báo cáo y học: "Comparative study between the Hybrid Capture II test and PCR based assay for the detection of human papillomavirus DNA in oral submucous fibrosis and oral squamous cell carcinoma" pdf

... indentifying the association of HR-HPV types with these oral lesions The purpose of this study was to compare the efficacy of HC -II assay and PCR for the detection of specific HPV type (HPV 16 E6) in ... sensitivity has been developed known as hybrid capture II test (HC -II) and approved by the US food and drug administration (FDA) The perform...

Ngày tải lên: 12/08/2014, 01:22

10 454 0
Báo cáo y học: " A novel duplex real-time reverse transcriptase-polymerase chain reaction assay for the detection of hepatitis C viral RNA with armored RNA as internal control" docx

Báo cáo y học: " A novel duplex real-time reverse transcriptase-polymerase chain reaction assay for the detection of hepatitis C viral RNA with armored RNA as internal control" docx

... 5'-AGCGTCTAGCCATGGCGTTAGTAT-3' 74 97 Ba 5'-TCCTCGCAATTCCGGTGTACTC-3' 161 182 Bp FAM5'-CCCCCCTCCCGGGAGAGCCATAGT-3' BHQ 121 144 ICp Cy55'-TTCCGCTGCCTGCTCAGTCGATCC-3' BHQ BHQ: Black Hole Quencher ... LOD of the duplex real-time RT-PCR assay was 38.99 IU/ml and the specificity was 100% Furthermore, the cost of the duplex real-time RT-PCR assay was considerably lower than t...

Ngày tải lên: 12/08/2014, 04:20

9 322 0
Báo cáo khoa học: " Development of a fluorescent quantitative real-time polymerase chain reaction assay for the detection of Goose parvovirus in vivo" ppsx

Báo cáo khoa học: " Development of a fluorescent quantitative real-time polymerase chain reaction assay for the detection of Goose parvovirus in vivo" ppsx

... template DNA preparation GPV CHV strain, a high-virulence strain of GPV, was obtained from Key Laboratory of Animal Diseases and Human Health of Sichuan Province Aleutian disease virus (ADV), canine ... size (bp) GPV-F GPV-R GPV-FP GTGCCGATGGAGTGGGTAAT ACTGTGTTTCCCATCCATTGG 6FAM-FTCGCAATGCCA ATTTCCCGAGGP TAMRA AAGCTTTGAAATGGCAGAGGGAGGA GGATCCCGCCAGGAAGTGCTTTATTTGA 3084-3103 3122-3143...

Ngày tải lên: 12/08/2014, 04:20

7 338 0
Báo cáo khoa học:" Development of TaqMan® MGB fluorescent real-time PCR assay for the detection of anatid herpesvirus 1?" pdf

Báo cáo khoa học:" Development of TaqMan® MGB fluorescent real-time PCR assay for the detection of anatid herpesvirus 1?" pdf

... demonstrated that the established FQ -PCR assay is of highly specific The intra -assay and inter -assay CV of this established FQPCR was in the range of 1–3% for most of the dynamic range (from 1.0 × 109 ... TaqMan real-time PCR method Results Development and optimization of FQ -PCR and conventional PCR Following the optimization of FQ -PCR, final concent...

Ngày tải lên: 12/08/2014, 04:21

8 266 0
Báo cáo khoa học: "Improvement of a real-time RT-PCR assay for the detection of enterovirus RNA" ppt

Báo cáo khoa học: "Improvement of a real-time RT-PCR assay for the detection of enterovirus RNA" ppt

... Poelstra E, Hooghiemstra M, Brandenburg AH: Clinical validation of a new real-time PCR assay for detection of enteroviruses and parechoviruses, and implications for diagnostic procedures Journal of ... 39:4093-4096 Verstrepen WA, Bruynseels P, Mertens AH: Evaluation of a rapid real-time RT-PCR assay for the detection of enterovirus RNA in cerebrospinal fl...

Ngày tải lên: 12/08/2014, 04:21

3 339 0
Báo cáo khoa học: "Verification of the Combimatrix influenza detection assay for the detection of influenza A subtype during the 2007–2008 influenza season in Toronto, Canada" pot

Báo cáo khoa học: "Verification of the Combimatrix influenza detection assay for the detection of influenza A subtype during the 2007–2008 influenza season in Toronto, Canada" pot

... The purpose of this study was to evaluate the sensitivity and specificity of the CombiMatrix influenza A detection system for influenza A subtype analysis compared to the Luminex RVP assay, an ... becoming increasingly prevalent in clinical microbiology laboratories, and is essential for public health surveillance of circulating strains, determination of a...

Ngày tải lên: 12/08/2014, 04:21

3 246 0
Báo cáo khoa học: " Development of TaqMan® MGB fluorescent real-time PCR assay for the detection of anatid herpesvirus 1" pdf

Báo cáo khoa học: " Development of TaqMan® MGB fluorescent real-time PCR assay for the detection of anatid herpesvirus 1" pdf

... demonstrated that the established FQ -PCR assay is of highly specific The intra -assay and inter -assay CV of this established FQPCR was in the range of 1–3% for most of the dynamic range (from 1.0 × 109 ... TaqMan real-time PCR method Results Development and optimization of FQ -PCR and conventional PCR Following the optimization of FQ -PCR, final concent...

Ngày tải lên: 12/08/2014, 04:21

8 367 0
Báo cáo khoa học: "Improvement of a real-time RT-PCR assay for the detection of enterovirus RNA" doc

Báo cáo khoa học: "Improvement of a real-time RT-PCR assay for the detection of enterovirus RNA" doc

... Poelstra E, Hooghiemstra M, Brandenburg AH: Clinical validation of a new real-time PCR assay for detection of enteroviruses and parechoviruses, and implications for diagnostic procedures Journal of ... 39:4093-4096 Verstrepen WA, Bruynseels P, Mertens AH: Evaluation of a rapid real-time RT-PCR assay for the detection of enterovirus RNA in cerebrospinal fl...

Ngày tải lên: 12/08/2014, 04:22

3 326 0
Báo cáo khoa học: "TaqMan reverse transcription polymerase chain reaction for the detection of Japanese encephalitis virus" pot

Báo cáo khoa học: "TaqMan reverse transcription polymerase chain reaction for the detection of Japanese encephalitis virus" pot

... **TCID50/25 µl RNA reaction TaqMan RT-PCR for the detection of Japanese encephalitis virus 349 Fig Sensitivity of real-time RT-PCR assay for quantitative detection of JEV (A) and detection of JEV by ... transmission of Japanese encephalitis virus to pigs in a region free of epidemic encephalitis Southeast Asian J Trop Med Public Health 1985, 16, 199-206 T...

Ngày tải lên: 07/08/2014, 18:20

7 334 1
Bệnh hoại tử cơ ở tôm thẻ chân trắng-infectious myonecrosis virus – IMNV docx

Bệnh hoại tử cơ ở tôm thẻ chân trắng-infectious myonecrosis virus – IMNV docx

... môi trường có ảnh hưởng đến trình bộc phát bệnh hoại tử Hình1 Bệnh hoại tử Infectious myonecrosis virus (IMNV) (a) Hình chụp kính hiển vi điện tử, IMNV nhiễm tự nhiên tôm thẻ chân trắng Brazil; ... (RdRp) phân loại IMNV vào họ Totiviridae, giống Giardiavirus Triệu chứng Tôm thẻ chân trắng ghi nhận vật chủ IMNV khả gây tỉ lệ chết cao loài tôm IMNV thường...

Ngày tải lên: 02/04/2014, 10:20

7 860 5
w