Mo(nu)ments in soz baroque exploring an inheritance of socialist memory
Mo(nu)ments in soz baroque exploring an inheritance of socialist memory
... •t:ev.March2Q-10 I _I MO(NU)MENTS IN SOZ- BAROQUE Exploring an Inheritance of Socialist Memory by Anna S Antonova Cassandra Cleghorn, Adviser A thesis submitted in partial fulfillment of the requirements ... States and the United Kingdom This results in a series of bombings on Sofia during the winter and spring of 1943-1944 10th of January 1944 – One of many b...
Ngày tải lên: 21/09/2015, 21:31
Tài liệu Systemic Risk in the Financial Sector: An Analysis of the Subprime-Mortgage Financial Crisis pdf
... Preprints of the Max Planck Institute for Research on Collective Goods Bonn 2008/43 Systemic Risk in the Financial Sector: An Analysis of the Subprime-Mortgage Financial Crisis Martin Hellwig ... claims of the senior and mezzanine tranches, the holders of the mezzanine tranche get the entire excess of the return over the claim of the senior...
Ngày tải lên: 17/02/2014, 21:20
Managing diffuse water pollution in South East Queensland: An analysis of the role of the Healthy Waterways Partnership docx
... starting in the 1820s with the arrival of European settlers and the development of agriculture Managing diffuse water pollution in SEQ: an analysis of the role of the Healthy Waterways Partnership ... of the legal and institutional framework governing water quality in SEQ Managing diffuse water pollution in SEQ: an analysis of...
Ngày tải lên: 06/03/2014, 15:21
Báo cáo khoa học: Metabolomics, modelling and machine learning in systems biology – towards an understanding of the languages of cells potx
... hypothesis-driven science in the postgenomic era Bioessays 26, 99105 17 Kell DB (2005) Metabolomics, machine learning and modelling: towards an understanding of the language of cells Biochem Soc Trans 33, 520524 ... models and reality on one hand and between changes in the model that are invoked and its subsequent dynamic behaviour, leading to an unders...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo hóa học: " Leg joint power output during progressive resistance FES-LCE cycling in SCI subjects: developing an index of fatigue" doc
... purposes) Journal of NeuroEngineering and Rehabilitation 2008, 5:14 Figure Resistance vs Ankle Power Output Resistance vs Ankle Power Output The height of the bars indicate mean ankle power output for ... one-way analysis of variance (ANOVA) was performed in order to evaluate the difference in mean cadence, mean stimulation intensity, mean joint power outputs, to...
Ngày tải lên: 19/06/2014, 08:20
Báo cáo lâm nghiệp: "Element analysis of tree rings in pedunculate oak heartwood: an indicator of historical trends in the soil chemistry, related to atmospheric deposition" ppsx
... each other, and to test the interest of tree- ring analysis 1994); a more METHODS We selected the Amance State Forest, about 000 ha, in the Lorraine plain, 15 km northeast of Nancy, in the northeast ... availability of these elements in the soil This may be an indication of acidification of the soil Acidification in a soil, whatever its causes, is th...
Ngày tải lên: 08/08/2014, 18:21
Báo cáo khoa học: "Variation of vessel lumen diameter in radial direction as an indication of the juvenile wood growth in oak" pptx
... the increase of cambial age of growth rings up to about 30 yr The vessel lumen diameter remained more or less constant with any further increase of the cambial age of growth rings Increase in the ... However, an increase in the diameter of latewood vessel lumina in the outerwood zone, in comparison with the vessel in the corewood zone was...
Ngày tải lên: 08/08/2014, 19:21
Báo cáo y học: " Critical Care in the Emergency Department: An assessment of the length of stay and invasive procedures performed on critically ill ED patients" doc
... management of critically ill patients in the ED is incomplete The primary objective of this study is to determine the length of stay of critically ill patients receiving care in a tertiary care adult emergency ... patients in the ED and an apparent disparity in invasive procedures employed in the ED Current evidence suggests that agg...
Ngày tải lên: 13/08/2014, 23:20
Maternal disciplinary practices in south indian mothers an analysis of situational, parent and child variables b
... at achieving a better understanding of < /b> the parentchild relationship and < /b> how parents discipline their children The results from this project can be used also to obtain insight into how parents ... Work and < /b> Psychology, National University of < /b> Singapore, Singapore 117570 Dear Mother, I am a Ph.D candidate at the National University of < /b> Singapore (NUS) and < /b>...
Ngày tải lên: 15/09/2015, 17:09
Maternal disciplinary practices in south indian mothers an analysis of situational, parent and child variables
... Work and Psychology, National University of Singapore, Singapore 117570 Dear Mother, I am a Ph.D candidate at the National University of Singapore (NUS) and am studying parental disciplinary practices ... practices I am interested in collecting data from the Indian parent population, particularly from Chennai The age groups of children that I am interested in are 3-4 y...
Ngày tải lên: 15/09/2015, 17:09
Biopolitics in science fiction films an exploration of the representation of the contemporary politicization of human biological life in cinema
... I find the dehumanizing of human life as such particularly interesting in analyzing science fiction films as their narratives are replete with representations of animal men The Animal Man and ... legislation of the entire world), but was an animal-man: man in the animal and the animal man 56 Many of inhumane crimes have been justified by the use of dehuma...
Ngày tải lên: 02/10/2015, 12:55
Biopolitics in science fiction films an exploration of the representation of the contemporary politicization of human biological life in cinema
... I find the dehumanizing of human life as such particularly interesting in analyzing science fiction films as their narratives are replete with representations of animal men The Animal Man and ... legislation of the entire world), but was an animal-man: man in the animal and the animal man 56 Many of inhumane crimes have been justified by the use of dehuma...
Ngày tải lên: 13/10/2015, 16:41
Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf
... 5¢-d(TCAGAAATTAAAGCGG ATGCATTATTTGCATG)-3¢ The upstream primer containing the NdeI restriction site (underlined) was: 5¢-d(GCTAGCATATGAAGCTTAAA AAAATTG)-3¢ and the downstream primer containing the ... value almost 2.5-fold higher than the native cold adapted enzyme (Table 1) The mutant G26 1A /Y2 6 9A exhibits an Ea almost the same as in the case of the native enzy...
Ngày tải lên: 22/02/2014, 04:20