Application of titanium silicide as an interconnect in deep submicron integrated chip manufacturing 2
... The use of pre-amorphizing implants to enhance the formation of the C54 phase titanium silicide has been studied in terms of the kinetics of formation Increasing the ramp-up rate during the first ... resulting in larger amounts of C54-TiSi2 Page 83 Study of Titanium Silicide Formation using Spike Anneal After the formation of the C54-TiSi2 phase during the spike anne...
Ngày tải lên: 17/09/2015, 17:20
... hence studied in the present investigation Both new and improved processing techniques based on current vii manufacturing tools are investigated and integrated into an existing manufacturing process, ... Noyce in 1959, investigation of the materials and their integration into the manufacturing processes has been an integral part of the development for faster and more power...
Ngày tải lên: 11/09/2015, 14:27
... ATTTCAGCAGCATACTCCACAATAAAAAG GATCCGCTTTGTGTAAGTAATTTGATTCAAGAA TCAAATTACTTACAAGTTTTTTGAATTCTCGAGA AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATT TGATCTCTTGAACAAATTACTTACACAAAGAG AGGGAATTCATGGCGCCGCTAGACCTGGC GAGGCCTCGAGTCAAAGGAAATATGGCGTTG ... PPP6C-3¢UTR-mut-antisense PPP6C-siR-Top GACGGCTCGAGGACCAAGGGGCTGTATGCAC GCCAGAAGCTTCCTGCCCTGTTCATCTGCAGG CGGGATCCTCTTGTATTACCCTCTA GCGAATTCTCCATCGTGCC TTTTTAT...
Ngày tải lên: 14/03/2014, 23:20
Báo cáo khoa học: Identification of sodium salicylate as an hsp inducer using a simple screening system for stress response modulators in mammalian cells pptx
... Ishihara et al (Eur J Biochem 270) Here we examined the effects of SA on stress response in mammalian cells using a simple screening system, and revealed that SA is a potent Hsp inducer in mammalian ... expression of endogenous heat shock proteins such as Hsp1 0 5a and Hsp7 0 in various mammalian cells Enhancement of thermoresistance of cells...
Ngày tải lên: 17/03/2014, 10:20
Báo cáo khoa học: " Application of ventriculoperitoneal shunt as a treatment for hydrocephalus in a dog with syringomyelia and Chiari I malformation" pptx
... etubirtnoc ton did aileymognirys dna noitamroflam I iraihC taht dna sulahapecordyh fo tluser a ylniam saw aixata eht taht tseggus nac ew ,suhT deniamer llits aileymognirys dna noitamroflam I iraihC ... yllanoitidart neeb sah taht nigiro niatrecnu na fo redrosid a si noitamroflam I iraihC )2 giF( aileymognirys dna noitamroflam I iraihC osla tub ,selcirtnev laretal eht fo noitatalid...
Ngày tải lên: 07/08/2014, 18:21
Báo cáo y học: "Perceptions of vaginal microbicides as an HIV prevention method among health care providers in KwaZulu-Natal, South Africa" pdf
... researchers investigate HCPs level of awareness and opinions regarding the promotion of vaginal microbicides as an HIV prevention method HCPs' also play a key role in determining the best channels ... they play as educators, have been found to significantly influence PUs acceptance of a product [2-4] Bearing this in mind, as well as the fact that new HIV infect...
Ngày tải lên: 10/08/2014, 05:20
Báo cáo y học: "Correspondence in relation to the case report "Capnography as an aid in localizing the phrenic nerve in brachial plexus surgery. Technical note." published in May issue of Journal of Brachial Plexus and Peripheral Nerve Injury" potx
... Ventilator setting here is very important They have not mentioned anything about the ventilator rate and tidal volume setting in their particular case in relation to capnogram recording Hypocarbia ... this possibility in the case report Even nothing was mentioned about occurrence of hiccup, which is usually seen in case of phrenic nerve stimulation [5] This i...
Ngày tải lên: 10/08/2014, 10:20
Báo cáo y học: "Ketamine as an adjuvant in sympathetic blocks for management of central sensitization following peripheral nerve injury" pptx
... with heat and mechanical allodynia Ketamine has been administered orally, as an ointment, intravenously, subcutaneously, epidurally and intramuscularly in a number of case reports in literature[17-19] ... administration of Ketamine – as an adjuvant in sympatholytic blocks [stellate ganglion block] to treat neuropathic pain We also highlight an unusual positive sensory...
Ngày tải lên: 10/08/2014, 10:20
an application of games and other stimulating activities in teaching pronunciation to grage 10 english gifted student at ha noi specialised upper secondary school
... games and some other stimulating activities? What are students’ attitude towards the use of games and some other stimulating activities? Scope of the study To create motivation for students in pronunciation ... low 10 What you think of games and other stimulating activities your teacher uses in your pronunciation lessons? a Very interesting and...
Ngày tải lên: 19/12/2014, 13:27
An application of games and other stimulating activities in teaching pronunciation Áp dụng trò chơi và các hoạt động mang tính khích lệ khác trong việc dạy phá
... to understand the notion of “importance” 1.2.3 Current ideas on pronunciation teaching and learning Changing outlooks on language learning and teaching have influenced the view of language competence, ... of learning 1.3 The use of games and other communicative activities in pronunciation teaching As discussed above, pronunciation is an essential part in...
Ngày tải lên: 28/03/2015, 09:27
Tài liệu Application of Genetic Algorithms and Simulated Annealing in Process Planning Optimization pptx
... 9.6 Introduction Modeling Process Planning Problems in an Optimization Perspective Applying a Genetic Algorithm to the Process Planning Problem Applying Simulated Annealing to the Process Planning ... 9 Application of Genetic Algorithms and Simulated Annealing in Process Planning Optimization 9.1 9.2 9.3 Y F Zhang National University of Singapore...
Ngày tải lên: 25/12/2013, 19:15
Tài liệu Báo cáo khoa học: Multi-targeted activity of maslinic acid as an antimalarial natural compound pdf
... considered as potential antimalarial targets [22,23] Other proteases related to the maturation of parasites and the invasive process are also investigated as possible targets for specific antimalarial ... (an aspartic protease) and the aspartic protease inhibitor pepstatin A as controls The results (Table 2) showed that MA does not inhibit cathepsin D nor the aspartic protease ac...
Ngày tải lên: 14/02/2014, 14:20