0
  1. Trang chủ >
  2. Giáo Dục - Đào Tạo >
  3. Cao đẳng - Đại học >

Genetic variability and interactions of cymbidium mosaic virus and odontoglossum ringspot virus

Genetic variability and interactions of cymbidium mosaic virus and odontoglossum ringspot virus

Genetic variability and interactions of cymbidium mosaic virus and odontoglossum ringspot virus

... C A Chang, C S Loh and S M Wong (2002) Genetic variability in the coat protein genes of two orchid viruses: Cymbidium mosaic virus and Odontoglossum ringspot virus Archives of Virology 147: 1943-1954 ... mottle virus CaMV cauliflower mosaic virus CMV cucumber mosaic virus CPMV cowpea mosaic virus CTV citrus tristeza virus CymMV cymbidium mosaic virus MCMV maize chlorotic mottle virus ORSV odontoglossum ... Singapore P A Ajjikuttira, C S Loh and S M Wong (2002) Genetic variability in the coat protein genes of two orchid viruses: Cymbidium mosaic virus and Odontoglossum ringspot virus 17th World Orchid Conference,...
  • 188
  • 317
  • 0
Báo cáo khoa học: Interaction of Sesbania mosaic virus movement protein with the coat protein – implications for viral spread Soumya Roy Chowdhury and Handanahal Subbarao Savithri docx

Báo cáo khoa học: Interaction of Sesbania mosaic virus movement protein with the coat protein – implications for viral spread Soumya Roy Chowdhury and Handanahal Subbarao Savithri docx

... similarity with MPs of viruses from other genera Within sobemoviruses, the sequence of the SeMV MP was closest to that of the SBMV-Ark MP (32% sequence identity), and the identity with MPs of other ... Alfalfa mosaic virus Cucumber mosaic virus Cowpea mosaic virus Brome mosaic virus Tobamovirus Alfamovirus Cucumovirus Comovirus Bromovirus Percentage identity with SeMV Percentage similarity with ... function of the pH of the FEBS Journal 278 (2011) 25 7–2 72 ª 2010 The Authors Journal compilation ª 2010 FEBS 261 Interaction of SeMV MP with viral coat protein A B C S R Chowdhury and H S Savithri...
  • 16
  • 527
  • 0
Báo cáo lâm nghiệp:

Báo cáo lâm nghiệp: "Genetic variability and divergence among Italian populations of common ash (Fraxinus excelsior L.)" ppt

... for the definition of Italian Regions of Provenance for common ash, although a deeper knowledge of the ecological characteristics of the areas of the study, such as vegetational and phytogeographical ... Sequencing and Analysis Software) Genetic variability in common ash 161 Table I Details of site and stand characteristics of common ash populations from Italy which were sampled for the study ... pattern of genetic divergence among the populations studied reflects a story of short-term separation and consistent gene flow Low levels of genetic differentiation are typical of species such as common...
  • 10
  • 379
  • 0
Báo cáo sinh học:

Báo cáo sinh học: "Estimation of genetic variability and selection response for clutch length in dwarf brown-egg layers carrying or not the naked neck gene" pdf

... affecting clutch length Selection on clutch length in layers 233 4.2 Phenotypic trends, selection response, and the effect of the NA gene Selection for average clutch length in the dwarf laying ... by their genotype for the NA gene In addition to the investigation of the genetic variability of clutch length in dwarf layers, this experiment also made it possible to examine the effect of the ... In G12, an acute failure in water distribution affected the mean performance much more severely for line L2 than for line L1, and more severely for both selected lines than for the control line...
  • 20
  • 260
  • 0
Báo cáo sinh học:

Báo cáo sinh học: "Genetic variability and differentiation in red deer (Cervus elaphus L) of Central Europe" pps

... result In the French red deer, according to Lang (1987) all animals living in the Vosges originate from a small remaining population in the mountain range of Donon (m 500 individuals in 1870) ... Genetic differentiation in four European subspecies of red deer (Cervus elaphus L) Heredity 51, 561-580 Harris H, Hopkinson DA (1976) Handbook of Enzyme Electrophoresis in Human Genetics North Holland, ... (by summing up all polymorphic loci in the various demes) are rather high in the white-tailed deer, the reindeer and the roe deer, followed by the red deer In contrast, the fallow deer and the...
  • 18
  • 152
  • 0
Báo cáo sinh học:

Báo cáo sinh học: "Genetic variability and differentiation in roe deer (Capreolus capreolus L) of Central Europe" doc

... (1985) Transferrin variability and founder effect in Iceland reindeer, Rangifer tarandus L Hereditas 103, 161-164 (1986) Genetic variability in Norwegian wild reindeer (Rangifer tarandus Hereditas ... P of 12% and a mean H of 3.3% for 25 species of small non fossorial mammals Nevo et al (1984) give a mean P of 19.1% and H of 4.1% for 184 species of mammals, most of them being rodents and insectivores) ... al, 1988) the factors influencing the amount and distribution of biochemical genetic variation in one of the most abundant European deer species, the roe deer (Capreolus capreolus) , are only poorly...
  • 19
  • 203
  • 0
Báo cáo khoa học: The F13 residue is critical for interaction among the coat protein subunits of papaya mosaic virus doc

Báo cáo khoa học: The F13 residue is critical for interaction among the coat protein subunits of papaya mosaic virus doc

... the aggregation state of the protein, as mutation of this residue led to formation of either NLPs (F13Y and F13L) or monomeric forms of the protein (F13G, F13A, F13R, F13E, F13S), which were always ... et al F13 critical for interaction among the CP subunits monomeric form of the protein [10] This protein failed to assemble, form disks or interact with RNA in vitro [10] On the basis of this result, ... F13 critical for interaction among the CP subunits spectrum This suggests that the structure of both truncated forms is very similar Moreover, the presence of several peaks in the middle of the...
  • 11
  • 333
  • 0
Báo cáo y học:

Báo cáo y học: " Analysis of a new strain of Euphorbia mosaic virus with distinct replication specificity unveils a lineage of begomoviruses with short Rep sequences in the DNA-B intergenic region" pdf

... Gregorio-Jorge et al.: Analysis of a new strain of Euphorbia mosaic virus with distinct replication specificity unveils a lineage of begomoviruses with short Rep sequences in the DNA-B intergenic region ... strains A and B of Euphorbia mosaic virus respectively, are actually incompatible in replication, hence implying that these viruses probably represent distinct replicating lineages in natural ... establish a formal distinction between strains with similar RSDs, that represent actual replicating lineages, and replication- incompatible strains, that apparently not What is the function of the DNA-B...
  • 15
  • 694
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " Recombination analysis of Soybean mosaic virus sequences reveals evidence of RNA recombination between distinct pathotypes" potx

... Identification of two new starins of soybean mosaic virus Acta Phytophyl Sin 1986, 13:221-226 Pu ZQ, Cao Q, Fang DC, Xi BD, Fang CT: Identification of strains of soybean mosaic virus Acta Phytophyl ... of soybean mosaic virus classification based on virulence in resistanct soybean cultivars Phytopathology 1979, 69:467-470 Cho EK, Goodman RM: Evaluation of resistance in soybeans to soybean mosaic ... Kim YH, Kim KH: Complete genome sequences of the genomic RNA of Soybean mosaic virus strains G7H and G5 Plant Pathol 2003, 19:171-176 Domingo E, Holland JJ: RNAvirus mutations and fitness for...
  • 8
  • 172
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " Characterization of the RNA-binding properties of the triple-gene-block protein 2 of Bamboo mosaic virus" pdf

... non-viral Figure The RNA-binding properties of unfused TGBp2 The RNA-binding properties of unfused TGBp2 A Effect of salt concentration on the RNA-binding activity of unfused TGBp2 After UV-crosslinking ... Science Council of Republic of China Grant NSC 94 -23 11 -27 52- B-005-011-PAE and NSC96 -27 52- B-005009-PAE References The non-specific RNA binding of TGBp2 also raises the question of "how the non-specific ... property of TGBp2, which is responsible for the non-specific interaction between TGBp2 and viral RNA On the basis of the known topological properties of TGBp2 [9], we propose that the self-assembly of...
  • 6
  • 155
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Oligomerization of the human immunodeficiency virus type 1 (HIV-1) Vpu protein – a genetic, biochemical and biophysical analysis" ppt

... CATGGAGATGCAACCTATAATAGTAGCAATAGTAGCATT AGTAGTAGCAATAATAATAGCAATAGCTGTGTGGTCCATAGTAATCATAGAATAGG and NL-TM-R, AATTCCTATTCTATGATTACTATGGACCACACAGCTATT GCTATTATTATTGCTACTACTAATGCTACTATTGCTACTATTATAGGTTGCATCTC; ... GCTATTATTATTGCTACTACTAATGCTACTATTGCTACTATTATAGGTTGCATCTC; for the R5 vpu TM region, R5TM-F, CATGGAGATGTTAAATTTAGATTATAAATTAGGAGTAGG AGCATTGATAGTAGCACTAATCATAGCAATAGTCGTGTGGACCATAGTATATATAGAATAGG and R5-TM-R, AATT CCTATTCTATATATACTATGGTCCACACGACTATTGCTATGATTAGTGCTA ... GAATTCATGCAACCTATAATAGTAGCAATA and NL-R-GFP, GGATCCGCG CAGATCATCAATATCC; for R5 vpu, R5-X-F, GAATTCATGTTAAATTTAG ATTATAAATTAGGAGTAGG and R5-R-GFP, GGATCCTGCCAAATCATT AACATCCAAAA For colocalization...
  • 11
  • 436
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Genetic variation and recombination of RdRp and HSP 70h genes of Citrus tristeza virus isolates from orange trees showing symptoms of citrus sudden death disease" potx

... Phylogenetic and recombination analysis of 284 HSP7 0h gene fragments sampled from three Brazilian orange trees Phylogenetic and recombination analysis of 284 HSP7 0h gene fragments sampled from ... Brazilian trees were 75.9% for two RdRp sequences from tree C3 and 89.0% for two HSP7 0h sequences from tree C5 In all the trees we observed that RdRp diversity was greater than that of HSP7 0h Although ... trees Phylogenetic and recombination analysis of 286 RdRp gene fragments sampled from three Brazilian orange trees (A) Largely recombination free maximum likelihood phylogeny of 269 RdRp gene...
  • 7
  • 346
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Genetic diversity and silencing suppression effects of Rice yellow mottle virus and the P1 protein" doc

... suppressing the silencing of their RNA The Rice yellow mottle virus, belonging to the Sobemovirus genus, is endemic to Africa and is the major pathogen of irrigated rice [15,16] Its genome and particle ... representative of the diversity of P1 with a divergence up to 17.8% were selected These isolates are representative of the diversity of the other parts of the genome as phylogenetic reconstruction from the ... we highlighted the functional diversity of RYMV isolates on silencing suppression The functional diversity at the scale of virion is not correlated to genetic diversity of the P1 protein suppressor...
  • 12
  • 384
  • 0
Báo cáo lâm nghiệp:

Báo cáo lâm nghiệp: "Genetic variation and genotype by environment interactions of juvenile wood chemical properties in Pinus taeda " pps

... of juvenile wood (ring 3) and transition wood (ring 8), respectively Thin wafers (200 µm) from earlywood and latewood of ring and ring were taken using a microtome At least 300 mg of each sample ... the juvenile and transition wood (Fig 2) Variation in α-cellulose, coarseness, and fiber length was greater in transition wood than in juvenile wood In contrast, variation in lignin content was ... lignin, fiber length, and coarseness for the juvenile wood (ring 3), transition wood (ring 8) and for the combined wood from combined sites analysis α−Cellulose Lignin Fiber length Juvenile wood...
  • 8
  • 321
  • 0

Xem thêm

Từ khóa: recommendations for prevention and control of hepatitis c virus infectionprogress toward prevention and control of hepatitis c virus infectionrecommendations for prevention and control of hepatitis c virusprevention and control of hepatitis c virusinteractions of photons and electrons with atomswhich stored genetic information and catalyzed chemical reactions although rna catalysis was believed to be restricted to phosphate chemistryprevention of hepatitis c virusprevention of hepatitis c virus infectionblue screen of death after virus removalecology is the study of the interactions of living organismsblue screen of death after virus scanblue screen of death during virus scanluận văn đánh giá tình trạng nhiễm bệnh virus cucumber mosaic virus tobacco mosaic virus và tomato spotted wilt virus trên cà chua solanum lycopersicum ở tỉnh lâm đồng bằng kỹ thuật elisa và bưnghiên cứu bệnh virus khảm lùn ngô sugarcane mosaic virus scmv tại vùng chương mỹ đan phượng hà nội và sản xuất kháng huyết thanh chẩn đoán bệnhcultural variability and public perceptionBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ