Genetic variability and interactions of cymbidium mosaic virus and odontoglossum ringspot virus

... C A Chang, C S Loh and S M Wong (2002) Genetic variability in the coat protein genes of two orchid viruses: Cymbidium mosaic virus and Odontoglossum ringspot virus Archives of Virology 147: 1943-1954 ... mottle virus CaMV cauliflower mosaic virus CMV cucumber mosaic virus CPMV cowpea mosaic virus CTV citrus tristeza virus CymMV cymbidium mosaic vir...

Ngày tải lên: 17/09/2015, 17:19

... similarity with MPs of viruses from other genera Within sobemoviruses, the sequence of the SeMV MP was closest to that of the SBMV-Ark MP (32% sequence identity), and the identity with MPs of other ... Alfalfa mosaic virus Cucumber mosaic virus Cowpea mosaic virus Brome mosaic virus Tobamovirus Alfamovirus Cucumovirus Comovirus Bromovirus Percentage ident...

Ngày tải lên: 15/03/2014, 00:20

... for the definition of Italian Regions of Provenance for common ash, although a deeper knowledge of the ecological characteristics of the areas of the study, such as vegetational and phytogeographical ... Sequencing and Analysis Software) Genetic variability in common ash 161 Table I Details of site and stand characteristics of common ash populations from...

Ngày tải lên: 07/08/2014, 16:20

... affecting clutch length Selection on clutch length in layers 233 4.2 Phenotypic trends, selection response, and the effect of the NA gene Selection for average clutch length in the dwarf laying ... by their genotype for the NA gene In addition to the investigation of the genetic variability of clutch length in dwarf layers, thi...

Ngày tải lên: 14/08/2014, 13:22

... result In the French red deer, according to Lang (1987) all animals living in the Vosges originate from a small remaining population in the mountain range of Donon (m 500 individuals in 1870) ... Genetic differentiation in four European subspecies of red deer (Cervus elaphus L) Heredity 51, 561-580 Harris H, Hopkinson DA (1976) Handbook of Enzyme Electrophores...

Ngày tải lên: 14/08/2014, 20:20

... (1985) Transferrin variability and founder effect in Iceland reindeer, Rangifer tarandus L Hereditas 103, 161-164 (1986) Genetic variability in Norwegian wild reindeer (Rangifer tarandus Hereditas ... P of 12% and a mean H of 3.3% for 25 species of small non fossorial mammals Nevo et al (1984) give a mean P of 19.1% and H of 4.1% for 184 species of mammals, most of...

Ngày tải lên: 14/08/2014, 20:20

... the aggregation state of the protein, as mutation of this residue led to formation of either NLPs (F13Y and F13L) or monomeric forms of the protein (F13G, F13A, F13R, F13E, F13S), which were always ... et al F13 critical for interaction among the CP subunits monomeric form of the protein [10] This protein failed to assemble, form disks or interact with...

Ngày tải lên: 07/03/2014, 05:20

... Gregorio-Jorge et al.: Analysis of a new strain of Euphorbia mosaic virus with distinct replication specificity unveils a lineage of begomoviruses with short Rep sequences in the DNA-B intergenic region ... strains A and B of Euphorbia mosaic virus respectively, are actually incompatible in replication, hence implying that these...

Ngày tải lên: 12/08/2014, 01:22

... Identification of two new starins of soybean mosaic virus Acta Phytophyl Sin 1986, 13:221-226 Pu ZQ, Cao Q, Fang DC, Xi BD, Fang CT: Identification of strains of soybean mosaic virus Acta Phytophyl ... of soybean mosaic virus classification based on virulence in resistanct soybean cultivars Phytopathology 1979, 69:467-470 Cho EK, Goodman RM: Evaluation of resis...

Ngày tải lên: 12/08/2014, 04:21

... non-viral Figure The RNA-binding properties of unfused TGBp2 The RNA-binding properties of unfused TGBp2 A Effect of salt concentration on the RNA-binding activity of unfused TGBp2 After UV-crosslinking ... Science Council of Republic of China Grant NSC 94 -23 11 -27 52- B-005-011-PAE and NSC96 -27 52- B-005009-PAE References The non-specific RNA binding of TGB...

Ngày tải lên: 12/08/2014, 04:21

... CATGGAGATGCAACCTATAATAGTAGCAATAGTAGCATT AGTAGTAGCAATAATAATAGCAATAGCTGTGTGGTCCATAGTAATCATAGAATAGG and NL-TM-R, AATTCCTATTCTATGATTACTATGGACCACACAGCTATT GCTATTATTATTGCTACTACTAATGCTACTATTGCTACTATTATAGGTTGCATCTC; ... GCTATTATTATTGCTACTACTAATGCTACTATTGCTACTATTATAGGTTGCATCTC; for the R5 vpu TM region, R5TM-F, CATGGAGATGTTAAATTTAGATTATAAATTAGGAGTAGG AGCATTGATAGTAGCACTAATCATAGCAATAGTCGTGTGGACCAT...

Ngày tải lên: 18/06/2014, 18:20

... Phylogenetic and recombination analysis of 284 HSP7 0h gene fragments sampled from three Brazilian orange trees Phylogenetic and recombination analysis of 284 HSP7 0h gene fragments sampled from ... Brazilian trees were 75.9% for two RdRp sequences from tree C3 and 89.0% for two HSP7 0h sequences from tree C5 In all the trees we observed that RdRp diversit...

Ngày tải lên: 20/06/2014, 01:20

... suppressing the silencing of their RNA The Rice yellow mottle virus, belonging to the Sobemovirus genus, is endemic to Africa and is the major pathogen of irrigated rice [15,16] Its genome and particle ... representative of the diversity of P1 with a divergence up to 17.8% were selected These isolates are representative of the diversity of the ot...

Ngày tải lên: 20/06/2014, 01:20

... of juvenile wood (ring 3) and transition wood (ring 8), respectively Thin wafers (200 µm) from earlywood and latewood of ring and ring were taken using a microtome At least 300 mg of each sample ... the juvenile and transition wood (Fig 2) Variation in α-cellulose, coarseness, and fiber length was greater in transition wood than in juvenile wood In con...

Ngày tải lên: 07/08/2014, 16:20