Pile behaviour subject to excavation induced soil movement in clay

... matrix of soil {Pp} Vector of pile- soil interaction forces acting on pile {Ps} Vector of pile- soil interaction forces acting on soil {yo} Vector of lateral soil movements at the pile nodes in the ... (2001) to study the responses of a single pile and pile groups due to excavation- induced soil movement in sand It was reported that the induced bending mom...

Ngày tải lên: 16/09/2015, 17:13

... CTGCGGTGCTGTTGTGG CACCATCATAAGGGTAAACAT ACAGCAAAAAGGAGGCCAAA GCCACAATCCAGTCATTCCA GATAAGCTTGTGGAAGTCGCGT TCTCACTGGCCCTAAACTGG CTGATAGGGGTTGGGTGATG GCATTTCCATTTCCCTAAGCAC CAACACAATCCTGAGGCACA TCCCTTTGCCTCCTGTTGTT ... CGGAAACGCCTTAAGTCCAG AATAAGCTTCCGACTCTAGCCGC AGCTGGTGCAGGAGGAAGTA CCGAGAACCGAACTTACCAA AGGAAGCACCCAGCAATACCA CACCTTGGATGGGTATTCCA CACAGCTCCCATTCATTCCA TCCTCCCTGGAGAAGAGCTA CTCCTGG...

Ngày tải lên: 06/03/2014, 22:21

... al.: Intra-abdominal hypertension due to heparin - induced retroperitoneal hematoma in patients with ventricle assist devices: report of four cases and review of the literature Journal of Cardiothoracic ... reduced, and the patient remained clinically stable under dobutamin & dopamine and heparin IV Heparin therapy was monitored three time...

Ngày tải lên: 10/08/2014, 09:22

... only, without providing their relationship to microcirculatory, metabolic and histopathological responses Prompted by these facts, we dynamically assessed the pattern of renal haemodynamics in ... porcine model of progressive hyperdynamic sepsis induced by faecal peritonitis Furthermore, a potential link between renal haemodynamics and renal cortex microcirculatory, m...

Ngày tải lên: 13/08/2014, 11:23

Ngày tải lên: 14/11/2014, 11:51

... movements of caisson subjected to strong waves 220 6.20 Total movements of caisson subjected to strong waves 221 6.21 Comparisons of analytical data with the field data of Typhoon ... Comparisons of measured and analytical total movements of caisson breakwater subject to wave loading during 51465-51510 s in WL7 (RD=80%)219 6.18 Elastic movements of caisson...

Ngày tải lên: 12/09/2015, 09:03

Ngày tải lên: 04/10/2012, 10:24

... the International Standard Banking Practice for the Examination of Documents under Documentary Credits (ISBP), ICC Publication 645 This publication has evolved into a necessary companion to the ... companion to the UCP for determining compliance of documents with the terms of letters of credit It is the expectation of the Drafting Group...

Ngày tải lên: 09/12/2013, 22:15

... TK1 In the first crystal structure of TK1- type enzymes of human and mycoplasmic origin [14], the feedback inhibitor dTTP was bound in the substrate pocket, similar to the binding of dTTP to the ... efficiency of ATP-incubated hTK1 is approximately 30-fold higher than that of non-incubated hTK1 The two TK1 forms can therefore be referred to as the hig...

Ngày tải lên: 18/02/2014, 12:20

... clear trend towards an apoptosis- inhibitory effect of the DR5 knockdown, indicating that basal expression of DR5 is required for the TRAIL sensitivity in these cells Apoptosis induced by TRAIL in ... reactivation of TRAIL-induced apoptosis observed in malignant glioma cells To address this question, we knocked down expression of DR5 by small interfering RNA (...

Ngày tải lên: 18/02/2014, 17:20

... of PrPC-induced cell drug resistance in gastric cancer cells PI3K/Akt is involved in the activation of P-gp by PrPC in gastric cancer To further investigate the underlying mechanism of PI3K/Akt- mediated ... significantly increased The results indicate that inhibition of the PI3K/Akt signaling pathway may lead to inhibition of the MDR indu...

Ngày tải lên: 07/03/2014, 03:20

... laquered oak top Please state which finish is required when ordering List Price Sale Price Code 3' Oak sleigh bed £648.00 £324.00 LIHFB30 3' Oak sleigh bed Rainbow £796.00 £398.00 LIHFB30RA 4'6" Oak ... £498.00 LIHFB46 4'6" Oak sleigh bed Rainbow £1,196.00 £598.00 LIHFB46RA 5'0 Oak Sleigh bed £1,116.00 £558.00 LIHFB50 5'0 Oak Sleigh bed Rainbow £1,396.00 £698.00 LIHFB50RA 6'0 O...

Ngày tải lên: 15/03/2014, 23:20

... field and laboratory studies; (iii) determine the relationship between Cd bioavailability and toxicity; and (iv) determine the factors that control Cd bioavailability and toxicity to soil microorganisms ... difficult In general, Cd shows more toxicity in sandy soils than in clay soils Soil solution Cd, and not the total concentration of Cd, seems to...

Ngày tải lên: 15/03/2014, 23:21

... growth in progressively increasing concentrations of stimulating Fas antibody [16] To investigate the molecular basis that underlies the resistance to Fas- induced apoptosis, the resistant cells ... 6G), indicating that increased phosphorylation of ERK1 ⁄ is not sufficient to mediate the resistance to Fas- induced apoptosis In conclusion, this suggests that t...

Ngày tải lên: 23/03/2014, 06:20