Characterization of zebrafish vitellogenin gene family for potential development of receptor mediated gene transfer method 5
... heterogenicity of vtg gene family and expressions of multiple vtg genes were investigated using a model fish, the zebrafish (Danio rerio) The study of vtg genes provides valuable information for further ... Red tilapia (Oreochromis mossambica) was used to explore the potential of using Vtgs as DNA carriers for development of a novel method for producing transgenic...
Ngày tải lên: 16/09/2015, 17:13
... Receptor- mediated gene transfer 24 hr, DNA~Vtg-pLys 144 24 hr, DNA~Vtg-pLys 144 24 hr, DNA 24 hr, DNA 24 hr, DNA 48 hr, DNA~Vtg-pLys 144 48 hr, DNA~Vtg-pLys 144 48 hr, DNA 48 hr, DNA 60 55 % of total ... radioactivity % of recovered of whole fish 50 45 40 35 30 25 20 15 10 24 48 ovary 24 48 liver 24 48 gut 24 gill 48 24 48 heart 24 48 spleen 24 48 kidney 24 4...
Ngày tải lên: 16/09/2015, 17:13
... Chapter Expression of vtgs 3. 3 .3 Tissue localization of vtg mRNAs 3. 3 .3. 1 Expression of vtgs in the liver of female fish and E2 treated male fish 3. 3 .3. 1.1 Morphological observations of H&E stained ... of vtgs sizes of the amplified products were the same as estimated from vtg cDNA sequences, i.e., 1 73 bp for vtg1, 190 bp for vtg2 and 130 bp for vtg3 (Fig 3-...
Ngày tải lên: 16/09/2015, 17:13
Characterization of zebrafish vitellogenin gene family for potential development of receptor mediated gene transfer method 2
... full-length cDNA sequences of vtg1-7 A8** A17 A 22 A30 A67 A80 A87 A119 A 126 A139 A183 A186 A1 92 A193 A 220 A 227 A248 A250 A2 52 A253 A256 A257 A259 A269 A2 72 A290 A295 A296 A300 A306 A3 42 A349 A368 A371 ... (24 0) 44% (28 8) 43% (23 5) 47% (24 7) 40% ( 325 ) 49% (22 2) 39% (316) 48% (26 5) 40% (20 8) 47% (25 9) 43% (24 9) 46% ( 328 ) 52% (20 0) 43% (20 5) 43% (21 8) 46% (25 2) 43...
Ngày tải lên: 16/09/2015, 17:13
Characterization of zebrafish vitellogenin gene family for potential development of receptor mediated gene transfer method 1
... Chapter General Introduction 1. 1 Oogenesis and vitellogenesis 1. 1 .1 Oogenesis The development of an egg is known as oogenesis, which can be divided into different phases including 1) proliferation of ... harness of this gene transfer method will rely on the improvements of its reproducibility and the foreign gene integration rate 18 Chapter General Introduction D Par...
Ngày tải lên: 16/09/2015, 17:13
Pathomechanistic characterization of DMT1 mediated manganese cytotoxicity implications in neurodegeneration
... expressed in almost every population of cells in the brain, these results indicate the importance of DMT1 in mediating iron transport in the brain In addition, as an example of DMT1 mutation in human, ... expression of DMT1 was also found in the astrocytic end feet, suggesting the involvement of DMT1 in iron uptake from the endothelial cells lining of the B...
Ngày tải lên: 08/09/2015, 19:15
Tài liệu Báo cáo khoa học: Role of receptor-mediated endocytosis, endosomal acidification and cathepsin D in cholera toxin cytotoxicity pdf
... chloroquine and monensin interfered with the ATP-dependent intraendosomal degradation of internalized radioactive CT [6] Recently, we have identified an endosomal aspartic acid protease, cathepsin D, ... action of cholera toxin and cathepsin D T El Hage et al min) increased two-fold in endosomes isolated from CT-injected rats (closed squares), but this was not observed f...
Ngày tải lên: 19/02/2014, 02:20
Tài liệu Báo cáo khoa học: Characterization of the promoter for the mouse a3 integrin gene Involvement of the Ets-family of transcription factors in the promoter activity doc
... within )260/)119, we Ó FEBS 2002 Integrin a3 gene promoter (Eur J Biochem 269) 4529 Fig Effects of mutations in the Ets- and GATA-binding sites and the E-box of the mouse a3 integrin gene on promoter ... assay (EMSA) using the Ets consensus site at )133 As the involvement of the Ets consensus binding site at )133 in the promoter activity of th...
Ngày tải lên: 21/02/2014, 03:20
Molecular characterization and developmental expression patterns of the zebrafish twist gene family
... pattern with other species 83 4.5.1 Zebrafish twist1 a and twist1 b genes 83 4.5.2 Zebrafish twist2 85 4.5.3 Zebrafish twist3 86 4.6 Shared and unique expression sites of the zebrafish twist genes 86 ... proteins generated by the neighbor-joining method Figure 3.6: Gene structure of twist1 a, twist1 b, twist2 and twist3 Figure 3.7: RT-PCR of zebrafish...
Ngày tải lên: 16/10/2015, 15:38
Báo cáo y học: "Characterization of Human Erythrocytes as Potential Carrier for Pravastatin: An In Vitro Study"
... of pravastatin in human erythrocytes The current work studies effect of time, temperature as well as drug concentration on the process of pravastatin loading into human erythrocytes by endocytosis ... characterization of pravastatin loaded erythrocytes Hematological Indices To determine the effect of loading process on erythrocytes, normal erythrocytes, erythrocyt...
Ngày tải lên: 25/10/2012, 11:10
Biochemical characterization of thermophilic lignocellulose degrading enzymes and their potential for biomass bioprocessing
... breakdown of lignocellulosic biomass for the establishment of a robust and cost-efficient process for production of cellulosic ethanol Acknowledgements Financial support by the Center for Bioprocessing ... thermophilic consortia for cellulase and xylanase production [7, 27] These reports, however, lack information on the biochemical and kinetic properties of the...
Ngày tải lên: 05/09/2013, 16:11
Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx
... Prm3 was performed using the mutator primers Kin175 (5¢-CACCAGAGCTACTTACA CTGAATTCCAGAATAATCACAAGCAAATC -3 ; sense primer) vs its complement generating pGL3b:Prm3aOCT)1*, pGL3b:Prm3abOCT)1* and ... Prm3aaAP)1*, pGL3e:Prm3aaAP)1*, pGL3b:Prm3aaaAP)1* and pGL3e:Prm3aaaAP)1* Mutation of the Oct-1 element with the sequence aaA TGCa to aaTTCCa (core bases shown in uppercase letters) cen...
Ngày tải lên: 19/02/2014, 16:20
Báo cáo Y học: Identification and characterization of a new gene from Variovorax paradoxus Iso1 encoding N -acyl-D-amino acid amidohydrolase responsible for D-amino acid production pdf
... towards N- acetyl-D-methionine, N- acetyl-D-alanine, N- acetyl-D-leucine and N- chloroacetyl-D-phenylalanine than towards N- acetyl-D-valine, N- acetyl-D-phenylalanine, N- acetyl-D-tryptophan, N- acetyl-D-tyrosine ... A- 6-D50061: Alcaligenes xylosoxydans ssp xylosoxydans A- 6 N- acylD-glutamate amidohydrolase; Alicaligenes faecalis-DA1: Alcaligenes faecalis DA1 N- acyl D-amino...
Ngày tải lên: 08/03/2014, 16:20
Báo cáo khóa học: Isolation and characterization of the Xenopus HIVEP gene family ppt
... combinations of degenerate and specific primers and by rescreening the cDNA libraries The partial clones of XHIVEP2 and -3 covered 5.9 and 3.2 kb of the respective 3¢ ends and included 3¢-UTRs and poly(A)-tails ... analyze the function of XHIVEP in the context of Xenopus embryogenesis (data not shown) However, the interpretation of the in vivo role of...
Ngày tải lên: 30/03/2014, 13:20
báo cáo hóa học:" Gene expression profiling for molecular distinction and characterization of laser captured primary lung cancers" ppt
... transcription gene ↑ genes ↓ 10 genes ↑ genes ↓ 22 genes ↑ genes ↓ transport genes ↑ 12 genes ↓ 11 genes ↑ 15 genes ↓ genes ↑ 15 genes ↓ development gene ↑ genes ↓ genes ↑ genes ↓ 12 genes ↑ genes ↓ ... metabolism 11 genes ↑ 25 genes ↓ 34 genes ↑ 26 genes ↓ 22 genes ↑ 38 genes ↓ immune system genes ↑ 13 genes ↓ genes ↑ 19 genes ↓ genes ↑ 25 genes ↓ 13 genes ↓ genes ↑ genes ↓ 18 genes ↑ 10...
Ngày tải lên: 18/06/2014, 15:20