Synthesis of zr beta zeolite in fluoride medium and its appl

Synthesis of zr beta zeolite in fluoride medium and its applications in catalytic liquid phase reactions

... Al-containing Zr- beta zeolite 37 2.1.4 Synthesis of Ti -beta zeolite 37 2.1.5 Synthesis of Al- and Sn -beta zeolites 38 2.1.6 Synthesis of Al -beta sample in basic medium 38 2.1.7 Synthesis of Zr- SBA-15 ... zeolite beta in fluoride medium 1.2.3 Incorporation of other metal elements into zeolite beta 1.2.4 Synthesis mechanism of zeolite...

Ngày tải lên : 16/09/2015, 17:12

224
309
0

Báo cáo hóa học: " Controllable synthesis of flake-like Al-doped ZnO nanostructures and its application in inverted organic solar cells" doc

... Al concentrations in a solution of 0.025 M zinc nitrate [Zn(NO3)2·6H2O] and hexamethylenetetramine (HMT), we obtained ultrathin flake-like AZO nanostructures of high s and distinct morphology Moreover, ... 0.337, and a PCE of 1.04% With doping and mM Al concentrations, the J SC of devices increases to 10.26 and 11.08 mA cm -2 , and the PCE increases to 1.26% and 1....

Ngày tải lên : 20/06/2014, 22:20

6
488
0

Báo cáo khóa học: A single mutation that causes phosphatidylglycerol deﬁciency impairs synthesis of photosystem II cores in Chlamydomonas reinhardtii pdf

... to a major change in the supramolecular organization of the peripheral antenna The absence of LHCII oligomers in these strains leads to the accumulation of LHCII monomers that presumably transfer ... in the pmf revertant strains (Fig 2) As observed in most PSII mutants identiﬁed so far in C reinhardtii [1], the strong decrease of apoCP47 and apoCP43 was accompanied by...

Ngày tải lên : 07/03/2014, 15:20

10
411
0

báo cáo hóa học:" Minireview: Transaminases for the synthesis of enantiopure beta-amino acids" doc

... potential for the synthesis of optically pure βamino acids These pyridoxal 5’-dependent enzymes catalyze the transfer of an amino group from a donor substrate to an acceptor, thus enabling the synthesis ... Advantages in the use of TAs lie in mostly low-cost substrates, no necessity for external cofactor recycling and the enzymes’ high enantioselectivity and reaction r...

Ngày tải lên : 21/06/2014, 17:20

38
520
0

Characterization of candida albicans cyclase associated protein CAP1 and its roles in morphogenesis g actin associates with the adenylyl cyclase cyr1 through cap1 and regulates cAMP synthesis in candida albicans hyphal morphogenesis

... CHARACTERIZATION OF CANDIDA ALBICANS CYCLASE- ASSOCIATED PROTEIN CAP1 AND ITS ROLES IN MORPHOGENESIS — G- actin Assoicates with the Adenylyl Cyclase Cyr1 through Cap1 and Regulates cAMP Synthesis ... resulting in impaired response to the hyphal- inducing signals Furthermore, the finding that the purified Cyr1 /Cap1/ actin complex...

Ngày tải lên : 12/09/2015, 09:55

137
294
0

Hydraulic modeling of open channel flows over an arbitrary 3-d surface and its applications in amenity hydraulic engineering

... contents of the following published and/ or accepted journal and conference papers: Anh T N and Hosoda T.: Depth-Averaged model of open channel flows over an arbitrary 3D surface and its applications ... predicted the water surface profile and velocity distribution well in simple channels, and the predictions of the model in main channel of compoun...

Ngày tải lên : 06/11/2012, 10:35

127
595
0

Báo cáo khoa học: Identiﬁcation and characterization of 1-Cys peroxiredoxin from Sulfolobus solfataricus and its involvement in the response to oxidative stress pdf

... thioredoxins were found In this study we examined the involvement of the peroxiredoxin Bcp2 in oxidative stress in the hyperthermophilic aerobic archaeon Sulfolobus solfataricus Furthermore, ... clariﬁed in detail and could play a key role in the detoxiﬁcation processes In this study we examined the role of Bcp2 in order to increase the knowledge...

Ngày tải lên : 07/03/2014, 12:20

11
565
0

Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

... sequence VBARP-L 1.9 VBARP-S 1.3 AACAATGCTGACTGATAGCGGAGGA (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 ... identiﬁed and functionally characterized VBARP, a novel splice variant of ANKHD1 Human ANKHD1 gene is a large transcript containing multiple ankyrin repeat motif domains a...

Ngày tải lên : 07/03/2014, 21:20

12
561
0

synthesis of hematite (r-fe2o3) nanorods diameter-size and shape effects on their

... the concentration of HCHO gas, which is certainly scientifically and technically interesting Conclusions In summary, we have described in this paper the shapecontrolled synthesis of hematite (R-Fe2O3) ... the formation of porous R-Fe2O3 and reminiscent of the orientation-ordered nanostructures for R-Fe2O3 in air conditions based on the combined analysis of DrTGA and...

Ngày tải lên : 20/03/2014, 13:08

7
602
1

Báo cáo khoa học: Huntington’s disease: roles of huntingtin-interacting protein 1 (HIP-1) and its molecular partner HIPPI in the regulation of apoptosis and transcription pptx

... Htt-interacting protein HIP -1 and its molecular partner HIPPI in the regulation of apoptosis and transcription, the two processes that are altered in HD [7,8] HIP -1 – its interacting partners and ... Conclusions HIP -1 and its interacting partner HIPPI together induce apoptosis by the intrinsic and extrinsic pathways Homer 1c, an interactor...

Ngày tải lên : 23/03/2014, 07:20

9
492
0

Báo cáo khoa học: Kinetic studies on endo-b-galactosidase by a novel colorimetric assay and synthesis of N -acetyllactosamine-repeating oligosaccharide b-glycosides using its transglycosylation activity pptx

... in this work (A) Consecutive additions of GlcNAc and Gal to Galb1-4GlcNAcb-pNP by b3GnT and b4GalT (B) Consecutive additions of GlcNAc and Gal to Galb1-4Glcb-pNP by b3GnT and b-D-galactosidase ... of that of The same tendency was seen in a comparison of and This was also the case for B fragilis endo-b-galactosidase as shown in Table Transglycosylation reaction o...

Ngày tải lên : 31/03/2014, 07:20

11
365
0

facile synthesis of zno micro-nanostructures with controllable morphology and

... growth of ZnO, and results in the morphology of ZnO changing from “wire” to “ﬂower”, “urchin” and “wire” with the addition of different amounts of ammonia Due to the different surface areas of the ... urchin-like ZnO; (b) sparse urchin-like ZnO; (c) orderly ZnO nanowire; (d) ﬂower-like ZnO; and (e) disorderly ZnO nanowire Table Photovoltaic parameters of micro-...

Ngày tải lên : 06/05/2014, 13:23

5
335
0

Báo cáo hóa học: " Facile preparation of highly-dispersed cobaltsilicon mixed oxide nanosphere and its catalytic application in cyclohexane selective oxidation" ppt

... Cite this article as: Zhang et al.: Facile preparation of highly-dispersed cobalt-silicon mixed oxide nanosphere and its catalytic application in cyclohexane selective oxidation Nanoscale Research ... two kinds of solution (solutions A and B) were obtained, respectively Solution A was composed of 15.05 g of NP-7, 35.05 g of cyclohexane, and 8.05 g of...

Ngày tải lên : 20/06/2014, 22:20

7
624
0

Báo cáo hóa học: " Atomic Layer Deposition of ZnO on Multi-walled Carbon Nanotubes and Its Use for Synthesis of CNT–ZnO " doc

... morphology of the ALD ZnO shell on CNTs The ﬁrst one is the surface conﬁguration of the CNTs As a micromolecular form of carbon, CNT can be regarded as graphitic layers (sp2hybridized carbon atoms) ... that the deposited ZnO layer can be used as a seed layer for the hydrothermal growth of ZnO nanorods This provides a new method for the fabrication of CNT ZnO thre...

Ngày tải lên : 21/06/2014, 08:20

5
350
0

Báo cáo lâm nghiệp: "Growth, allocation and leaf gas exchanges of hybrid poplar plants in their establishment phase on previously forested sites: eﬀect of diﬀerent vegetation" docx

... 3.4 Hybrid poplar biomass partitioning Variations in biomass partitioning were mainly associated to tree height (Tab II) In the 2YS, plants decreased their allocation to roots and rapidly increase ... testing such a set of treatments in natural conditions in regions not limited by water shortage are not common In addition, in Canada there have been few studies focusi...

Ngày tải lên : 07/08/2014, 16:20

11
290
0