Synthesis of zr beta zeolite in fluoride medium and its applications in catalytic liquid phase reactions

... Al-containing Zr- beta zeolite 37 2.1.4 Synthesis of Ti -beta zeolite 37 2.1.5 Synthesis of Al- and Sn -beta zeolites 38 2.1.6 Synthesis of Al -beta sample in basic medium 38 2.1.7 Synthesis of Zr- SBA-15 ... zeolite beta in fluoride medium 1.2.3 Incorporation of other metal elements into zeolite beta 1.2.4 Synthesis mechanism of zeolite...

Ngày tải lên: 16/09/2015, 17:12

... Al concentrations in a solution of 0.025 M zinc nitrate [Zn(NO3)2·6H2O] and hexamethylenetetramine (HMT), we obtained ultrathin flake-like AZO nanostructures of high s and distinct morphology Moreover, ... 0.337, and a PCE of 1.04% With doping and mM Al concentrations, the J SC of devices increases to 10.26 and 11.08 mA cm -2 , and the PCE increases to 1.26% and 1....

Ngày tải lên: 20/06/2014, 22:20

... to a major change in the supramolecular organization of the peripheral antenna The absence of LHCII oligomers in these strains leads to the accumulation of LHCII monomers that presumably transfer ... in the pmf revertant strains (Fig 2) As observed in most PSII mutants identified so far in C reinhardtii [1], the strong decrease of apoCP47 and apoCP43 was accompanied by...

Ngày tải lên: 07/03/2014, 15:20

... potential for the synthesis of optically pure βamino acids These pyridoxal 5’-dependent enzymes catalyze the transfer of an amino group from a donor substrate to an acceptor, thus enabling the synthesis ... Advantages in the use of TAs lie in mostly low-cost substrates, no necessity for external cofactor recycling and the enzymes’ high enantioselectivity and reaction r...

Ngày tải lên: 21/06/2014, 17:20

... CHARACTERIZATION OF CANDIDA ALBICANS CYCLASE- ASSOCIATED PROTEIN CAP1 AND ITS ROLES IN MORPHOGENESIS — G- actin Assoicates with the Adenylyl Cyclase Cyr1 through Cap1 and Regulates cAMP Synthesis ... resulting in impaired response to the hyphal- inducing signals Furthermore, the finding that the purified Cyr1 /Cap1/ actin complex...

Ngày tải lên: 12/09/2015, 09:55

... contents of the following published and/ or accepted journal and conference papers: Anh T N and Hosoda T.: Depth-Averaged model of open channel flows over an arbitrary 3D surface and its applications ... predicted the water surface profile and velocity distribution well in simple channels, and the predictions of the model in main channel of compoun...

Ngày tải lên: 06/11/2012, 10:35

... thioredoxins were found In this study we examined the involvement of the peroxiredoxin Bcp2 in oxidative stress in the hyperthermophilic aerobic archaeon Sulfolobus solfataricus Furthermore, ... clarified in detail and could play a key role in the detoxification processes In this study we examined the role of Bcp2 in order to increase the knowledge...

Ngày tải lên: 07/03/2014, 12:20

... sequence VBARP-L 1.9 VBARP-S 1.3 AACAATGCTGACTGATAGCGGAGGA (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 ... identified and functionally characterized VBARP, a novel splice variant of ANKHD1 Human ANKHD1 gene is a large transcript containing multiple ankyrin repeat motif domains a...

Ngày tải lên: 07/03/2014, 21:20

... the concentration of HCHO gas, which is certainly scientifically and technically interesting Conclusions In summary, we have described in this paper the shapecontrolled synthesis of hematite (R-Fe2O3) ... the formation of porous R-Fe2O3 and reminiscent of the orientation-ordered nanostructures for R-Fe2O3 in air conditions based on the combined analysis of DrTGA and...

Ngày tải lên: 20/03/2014, 13:08

... Htt-interacting protein HIP -1 and its molecular partner HIPPI in the regulation of apoptosis and transcription, the two processes that are altered in HD [7,8] HIP -1 – its interacting partners and ... Conclusions HIP -1 and its interacting partner HIPPI together induce apoptosis by the intrinsic and extrinsic pathways Homer 1c, an interactor...

Ngày tải lên: 23/03/2014, 07:20

... in this work (A) Consecutive additions of GlcNAc and Gal to Galb1-4GlcNAcb-pNP by b3GnT and b4GalT (B) Consecutive additions of GlcNAc and Gal to Galb1-4Glcb-pNP by b3GnT and b-D-galactosidase ... of that of The same tendency was seen in a comparison of and This was also the case for B fragilis endo-b-galactosidase as shown in Table Transglycosylation reaction o...

Ngày tải lên: 31/03/2014, 07:20

... growth of ZnO, and results in the morphology of ZnO changing from “wire” to “flower”, “urchin” and “wire” with the addition of different amounts of ammonia Due to the different surface areas of the ... urchin-like ZnO; (b) sparse urchin-like ZnO; (c) orderly ZnO nanowire; (d) flower-like ZnO; and (e) disorderly ZnO nanowire Table Photovoltaic parameters of micro-...

Ngày tải lên: 06/05/2014, 13:23

... Cite this article as: Zhang et al.: Facile preparation of highly-dispersed cobalt-silicon mixed oxide nanosphere and its catalytic application in cyclohexane selective oxidation Nanoscale Research ... two kinds of solution (solutions A and B) were obtained, respectively Solution A was composed of 15.05 g of NP-7, 35.05 g of cyclohexane, and 8.05 g of...

Ngày tải lên: 20/06/2014, 22:20

... morphology of the ALD ZnO shell on CNTs The first one is the surface configuration of the CNTs As a micromolecular form of carbon, CNT can be regarded as graphitic layers (sp2hybridized carbon atoms) ... that the deposited ZnO layer can be used as a seed layer for the hydrothermal growth of ZnO nanorods This provides a new method for the fabrication of CNT ZnO thre...

Ngày tải lên: 21/06/2014, 08:20

... 3.4 Hybrid poplar biomass partitioning Variations in biomass partitioning were mainly associated to tree height (Tab II) In the 2YS, plants decreased their allocation to roots and rapidly increase ... testing such a set of treatments in natural conditions in regions not limited by water shortage are not common In addition, in Canada there have been few studies focusi...

Ngày tải lên: 07/08/2014, 16:20