The role of nitric oxide and prostaglandin e2 in prolonged hemorrhagic shock 2
The role of nitric oxide and prostaglandin e2 in prolonged hemorrhagic shock 2
... performance The selective iNOS inhibitor, AG, may be of interest as a therapeutic agent following prolonged hemorrhagic shock 44 CHAPTER Prolonged hemorrhagic shock model: The role of NO and PGE2 and the ... NO and COX -2 in Prolong hemorrhagic shock 1.6 The role nitric oxide and angiotensin II play in prolonged hemorrhagic shock The re...
Ngày tải lên: 16/09/2015, 15:54
The role of nitric oxide and prostaglandin e2 in prolonged hemorrhagic shock 1
... percussion injury Keywords: prolonged hemorrhagic shock; fluid percussion injury; nitric oxide; prostaglandin E2; aminoguanidine ix SUMMARY OF THESIS In our study of prolonged hemorrhagic shock, the ... following fluid percussion injury and hemorrhagic shock xv Aims of this thesis is to investigate Pathophysiology of prolonged hemorrhagic shock Role...
Ngày tải lên: 16/09/2015, 15:54
The role of nitric oxide and other gaseous mediators in cardiovascular disease models; emphasis on septic shock
... THE ROLE OF NITRIC OXIDE AND OTHER GASEOUS MEDIATORS IN CARDIOVASCULAR DISEASE MODELS: EMPHASIS ON SEPTIC SHOCK FARHANA ANUAR B.Sc.(Hons.), NUS A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF ... pathogenesis of tissue damage incurred by the host in the course of severe sepsis and septic shock 2.3 Evidence for the involvement of NO in...
Ngày tải lên: 14/09/2015, 14:16
Báo cáo y học: "The role of mast cells and fibre type in ischaemia reperfusion injury of murine skeletal muscles" pot
... base line level of susceptibility to ischaemia induced injury that can be attributed to mouse strain and muscle fibre type Mast cells independently exacerbate IR injury during a clinically relevant ... mast cells into Wf/Wf mice restores susceptibility to IR injury, thus proving that mast cells play a pivotal role in IR injury to skeletal muscle [5] Our IR...
Ngày tải lên: 11/08/2014, 08:21
Báo cáo y học: " The role of cyclin D2 and p21/waf1 in human T-cell leukemia virus type 1 infected cells" potx
... that p 21/ waf1 and cyclin D2 are complexed together in HTLV -1 infected cells Cell cycle analysis of cyclin D2 and p 21/ waf1 p 21/ waf1 has been previously described as an assembly factor for cyclin ... Cyc D2 CDK2 + CycE + p 21/ waf1 (WT, 10 0ng) D) CDK4 + Cyc D2 CDK2 + CycE B) CDK4 + CycD2 + p16/INK4A CDK4 + CycD2 + p 21/ waf1 (mut) CDK4 + CycD2 + p 21/...
Ngày tải lên: 13/08/2014, 13:20
the role of ikkalpha, ikkbeta and nf-kappab in the progression of breast cancer
... The role of IKKalpha, IKKbeta and NF-kappaB in the progression of breast cancer Lindsay Bennett BSc(Hons), MSc Submitted in fulfillment of the requirements for the degree of PhD Institute of ... 16% of familial breast cancers not being linked to either of these genes [23] Mutations in both BRCA1 and BRCA2 also increase the risk of ovarian c...
Ngày tải lên: 22/12/2014, 21:49
Blogging and collective action the role of collective identity and social networks in engendering change
... as the process of collective identity building among political bloggers in influencing their crossover from online to offline participation in collective action Taking into account the role of ... translate into some form of collective action offline By incorporating these key elements and variables in the study of political blogging in Singapore, this...
Ngày tải lên: 10/09/2015, 15:52
The role of NF kb and histone deacetylase in gene regulation
... Chapter Introduction 11 1.4 NF- κB in inflammatory diseases and cancer NF- κB plays a critical role in inflammation and innate immunity through proinflammatory cytokine receptor signaling via the Toll-like ... DNA (Wu and Grunstein, 2000; Jenuwein and Allis, 2001) The opposing actions of histone acetylases (HATs) and histone deacetylases (HDACs) on the lysine re...
Ngày tải lên: 14/09/2015, 08:45
Báo cáo y học: " Central role of nitric oxide in the pathogenesis of rheumatoid arthritis and systemic lupus erythematosus" potx
... abnormalities in systemic lupus erythematosus Curr Immunol Rev 2005, 1:61-67 Perl A: Emerging new pathways of pathogenesis and targets for treatment in systemic lupus erythematosus and Sjogren’s syndrome ... regulates mammalian target of rapamycin activity and TCRζ expression in SLE The mammalian target of rapamycin (mTOR) is a serine/ threonine protein kinase a...
Ngày tải lên: 12/08/2014, 14:22
Role of nitric oxide in wound healing facilitatory effects of nitrosoglutathione a nitric oxide donor on the extracellular matrix deposition characteristics of wound healing
... important parameters They are a) rate of wound healing, b) collagen content of the scar and c) Biomechanical strength 1.2.1 Rate of wound contraction Clinically, evaluation of wound healing is done ... leading to rapid wound closure Preparation of the wound bed, choice of growth factor appropriate to the stage of healing, and quantity and duration of admin...
Ngày tải lên: 17/09/2015, 17:19
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
... CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA GAACCTTTATTCGCTATTGGTACCGGTAAA GAACCTTTATTCGCTATTGGTACCGGTAAA TCACCGGTCCATGATCCATT NcoI KpnI KpnI HaeIII 4178 FEBS Journal 276 (2009) 41694183 ê 2009 The Authors ... maintain the unusual Ramachandran angles for the K12 residue, and a Ramachandran scatter plot for the K12 residues in 21 TIM structures from various sources (available f...
Ngày tải lên: 18/02/2014, 11:20
Tài liệu Research " THE ROLE OF IMPORT SUBSITITUTION AND EXPORT ORIENTATION STRATEGIES ON THAILAND''''ECONOMIC GROWTH " ppt
Ngày tải lên: 18/02/2014, 11:20
Báo cáo khoa học: The role of helix 8 and of the cytosolic C-termini in the internalization and signal transduction of B1 and B2 bradykinin receptors potx
... in Role of helix and C-termini in bradykinin receptors receptor signaling because: (a) interruption of the amphipathic structure of B1wt helix in B1wt and B1KB2 through the presence of a serine ... TSIfiAAA N3 38* B1wt B1RB2 B1NB2 B1CB2 B1KB2 B1KB2 ⁄ SfiV B1KB2 ⁄ QGVfiKQ B1KB2 ⁄ VCfiCV B1YB2 B1V323S 10400 5020 52 98 383 2 625 127 511 1701 182 3 17 58 2142 1 786...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo khoa học: Local stability identification and the role of key acidic amino acid residues in staphylococcal nuclease unfolding ppt
... Local stability and key acidic amino acids in staphylococcal nuclease by the interactions of E75 with H121 and K97 It is believed that a small number of key amino acid segments play major roles ... 44% of E129G), respectively, lower DHcal values than the wild-type protein These outcomes indicate that little in uence is exerted by Gly 3969 Local stabilit...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: Cupiennin 1a, an antimicrobial peptide from the venom of the neotropical wandering spider Cupiennius salei, also inhibits the formation of nitric oxide by neuronal nitric oxide synthase pptx
... hydrophobic anchors Given the length of the first helix of cupiennin 1a, and the number of hydrophobic anchors available, it seems likely that the cupiennin 1a ⁄ Ca2+-CaM complex is analogous to the structure ... that cupiennin 1a also complexes with Ca2+-CaM, and is one of the more active of the known peptide inhibitors of nNOS Cupiennin 1a from Cupi...
Ngày tải lên: 23/03/2014, 09:21