A non mouse adapted dengue virus strain as a new model of severe dengue infection in AG129 mice

A non mouse adapted dengue virus strain as a new model of severe dengue infection in AG129 mice

A non mouse adapted dengue virus strain as a new model of severe dengue infection in AG129 mice

... has also been implicated in DEN disease; hence elevations in aspartate aminotransferase (AST) and alanine aminotransferase (ALT) levels (Burke et al., 1988), - indicative of liver damage - are ... levels of aspartate (AST) and alanine (ALT) transaminases ……………………………………………………………………… 85 Figure 5.13: Comparative analysis of vascular leakage and albumin concentration in D2Y98P sc infe...
Ngày tải lên : 16/09/2015, 15:43
167 245 0
Báo cáo khoa học: "A Rational Model of Eye Movement Control in Reading" pdf

Báo cáo khoa học: "A Rational Model of Eye Movement Control in Reading" pdf

... grained scale In this paper, we present a new rational model of eye movement control in reading, the central assumption of which is that eye movement decisions are made to obtain noisy visual information, ... constitutes a rational model of eye movement control in reading, extending the insights from previous results about rationality in language comprehe...
Ngày tải lên : 23/03/2014, 16:20
11 424 0
Báo cáo toán học: " Existence of solutions of a new system of generalized variational inequalities in Banach spaces" ppt

Báo cáo toán học: " Existence of solutions of a new system of generalized variational inequalities in Banach spaces" ppt

... Existence of solutions of a new system of generalized variational inequalities in Banach spaces Somyot Plubtieng∗ and Tipphawan Thammathiwat Department of Mathematics, Faculty of Science, Naresuan ... Berlin (1992) 11 Isac, G, Sehgal, VM, Singh, SP: An altenate version of a variational inequality Indian J Math 41, 25–31 (1999) 12 Kassay, G, Kolumb´n, J: Sy...
Ngày tải lên : 20/06/2014, 21:20
21 387 0
Báo cáo y học: "The significance of glucose, insulin and potassium for immunology and oncology: a new model of immunity" ppt

Báo cáo y học: "The significance of glucose, insulin and potassium for immunology and oncology: a new model of immunity" ppt

... Aljada A, Chaudhuri A, Bandyopadhyay A: The potential influence of inflammation and insulin resistance on the pathogenesis and treatmentof atherosclerosis-related complications in type-2 diabetes ... the bacteria [65] In our model that is what happens when high doses of GIK are administered intravenously for a period of several hours Reactivated lymphocytes attack pathoge...
Ngày tải lên : 11/08/2014, 10:23
12 430 0
Báo cáo y học: " Local therapy with CpG motifs in a murine model of allergic airway inflammation in IFN-β knock-out mice" doc

Báo cáo y học: " Local therapy with CpG motifs in a murine model of allergic airway inflammation in IFN-β knock-out mice" doc

... bronchial inflammation and airway hyperreactivity in mice Pharmacology 1997, 55:32-43 Satoh Y, Kasama K, Kuwabara M, Yimin, Diao HY, Nakajima H, Kohanawa M, Minagawa T: Suppression of late asthmatic ... after CpG treatment in a murine model of allergic inflammation Our results indicate that induction of Th1 response by therapy with CpG- ODN is partially depende...
Ngày tải lên : 12/08/2014, 18:21
12 315 0
Báo cáo khoa học: Subcellular compartmentalization of FADD as a new level of regulation in death receptor signaling pdf

Báo cáo khoa học: Subcellular compartmentalization of FADD as a new level of regulation in death receptor signaling pdf

... involving active caspase-8 Discussion FADD is an essential adaptor protein in the CD95mediated apoptotic signaling cascade that couples activated receptors with the activation of initiator caspase-8 ... triggering induces membrane proximal signals to induce nuclear export of FADD that are independent of CD95 internalization and ‘classic’ apoptotic signaling events, such as D...
Ngày tải lên : 07/03/2014, 02:20
10 483 0
Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf

Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf

... ATTTCAGCAGCATACTCCACAATAAAAAG GATCCGCTTTGTGTAAGTAATTTGATTCAAGAA TCAAATTACTTACAAGTTTTTTGAATTCTCGAGA AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATT TGATCTCTTGAACAAATTACTTACACAAAGAG AGGGAATTCATGGCGCCGCTAGACCTGGC GAGGCCTCGAGTCAAAGGAAATATGGCGTTG ... PPP6C-3¢UTR-mut-antisense PPP6C-siR-Top GACGGCTCGAGGACCAAGGGGCTGTATGCAC GCCAGAAGCTTCCTGCCCTGTTCATCTGCAGG CGGGATCCTCTTGTATTACCCTCTA GCGAATTCTCCATCGTGCC TTTTTAT...
Ngày tải lên : 14/03/2014, 23:20
11 396 0
Báo cáo y học: "Salivary gland derived peptides as a new class of anti-inflammatory agents: review of preclinical pharmacology of C-terminal peptides of SMR1 protein" pptx

Báo cáo y học: "Salivary gland derived peptides as a new class of anti-inflammatory agents: review of preclinical pharmacology of C-terminal peptides of SMR1 protein" pptx

... [http://www.fimdefelice.org/archives/arc.researchact html] doi:10.1186/1476-9255-7-49 Cite this article as: Mathison et al.: Salivary gland derived peptides as a new class of anti-inflammatory agents: review of preclinical ... was measured histologically, by determination of plasma amylase and lipase activity, and by immunoassays • In vitro and ex vivo studies on...
Ngày tải lên : 11/08/2014, 03:20
11 406 0
Báo cáo y học: " Cardiac tamponade mimicking tuberculous pericarditis as the initial presentation of chronic lymphocytic leukemia in a 58-year-old woman: a case report" pptx

Báo cáo y học: " Cardiac tamponade mimicking tuberculous pericarditis as the initial presentation of chronic lymphocytic leukemia in a 58-year-old woman: a case report" pptx

... However, tamponade as an initial manifestation of malignancy is relatively uncommon A review of 78 cases revealed that 60% of such cases stemmed from lung carcinomas whereas only 9% originated from leukemia ... above the manubriosternal angle The lung examination was unremarkable Her abdomen was soft and nondistended There was no peripheral edema, adenopathy or hepatosplem...
Ngày tải lên : 11/08/2014, 03:21
4 398 0
Báo cáo y học: "Cardiac tamponade mimicking tuberculous pericarditis as the initial presentation of chronic lymphocytic leukemia in a 58-year-old woman: a case report" pptx

Báo cáo y học: "Cardiac tamponade mimicking tuberculous pericarditis as the initial presentation of chronic lymphocytic leukemia in a 58-year-old woman: a case report" pptx

... However, tamponade as an initial manifestation of malignancy is relatively uncommon A review of 78 cases revealed that 60% of such cases stemmed from lung carcinomas whereas only 9% originated from leukemia ... above the manubriosternal angle The lung examination was unremarkable Her abdomen was soft and nondistended There was no peripheral edema, adenopathy or hepatosplem...
Ngày tải lên : 11/08/2014, 07:20
4 399 0
Báo cáo y học: " A new modality of treatment for non-united fracture of the humerus in a patient with osteopetrosis: a case report" pptx

Báo cáo y học: " A new modality of treatment for non-united fracture of the humerus in a patient with osteopetrosis: a case report" pptx

... Written informed consent was obtained from the patient for publication of this case report and any accompanying images A copy of the written consent is available for review by the Editor -in- Chief of ... frequently reversed and withdrawn for cleaning A standard 3.2 mm drill was used to attain the right diameter A plate of sufficient length was used to reach be...
Ngày tải lên : 11/08/2014, 19:21
3 298 0
Báo cáo y học: "The efficacy of Link N as a mediator of repair in a rabbit model of intervertebral disc degeneration" ppt

Báo cáo y học: "The efficacy of Link N as a mediator of repair in a rabbit model of intervertebral disc degeneration" ppt

... http://arthritis-research.com/content/13/4/R120 Figure Changes in DNA, proteoglycan (sulfated glycosaminoglycan) and hyaluronic acid content Changes in DNA, proteoglycan (sulfated glycosaminoglycan (GAG)) and hyaluronic acid ... aggrecan) as sulfated glycosaminoglycan using the 1,9-dimethylmethylene blue dye-binding assay [37], and for hyaluronate using a competitive hyaluronate-bindi...
Ngày tải lên : 12/08/2014, 17:22
9 402 0
Realizing an AD+ model as a derived model of a premouse

Realizing an AD+ model as a derived model of a premouse

... carrying out a detailed analysis of HOD of AD+ models below ADR + “✓ is regular” Theorem 1.8 (Sargsyan,[7]) Assume AD+ + V = L(P(R)) and suppose that there is no proper class inner model containing ... ADR +“✓ is regular” Sargsyan in an unpublished work carried out the HOD analysis of AD+ models below LST (the largest ✓ is a Suslin cardinal) The translation is likely to ge...
Ngày tải lên : 09/09/2015, 17:54
164 281 0
Báo cáo y học: " Implementation of a new emergency medical communication centre organization in Finland an evaluation, with performance indicators"

Báo cáo y học: " Implementation of a new emergency medical communication centre organization in Finland an evaluation, with performance indicators"

... Implementation of a new emergency medical communication centre organization in Finland - an evaluation, with performance indicators Scandinavian Journal of Trauma, Resuscitation and Emergency Medicine 2011 ... medical call centre organization reform in Finland Material and methods A retrospective observational study was conducted in the EMCC in...
Ngày tải lên : 25/10/2012, 10:02
5 495 0
Báo cáo y học: "Intrathecal siRNA against Toll-like receptor 4 reduces nociception in a rat model of neuropathic pain"

Báo cáo y học: "Intrathecal siRNA against Toll-like receptor 4 reduces nociception in a rat model of neuropathic pain"

... (5’-GGCGUGUCUCUCU UACGAC-3”) SiRNAs targeting the cDNA sequence of rat TLR4 (GenBank accession NM_019178) were: 5’-CUACCAACAGAGAGGAUAU-3” (siRNA1 ), 5’-GUCUCAGAUAUCUAGAUCU-3’ (siRNA2 ), 5’-GAGCCGGAAAGUUAUUGUG-3’ ... tissues was significantly lower in the CCI group during the course of 255 TLR4 -siRNA treatment, indicating that intrathecal administration of TLR4 -siRNA significantl...
Ngày tải lên : 25/10/2012, 11:48
9 487 0
Từ khóa: