A critical analysis of hsi mu rens poetry from a marginal perspective journey embarked on the greenland in search of humanity

báo cáo khoa học: " A win-win solution?: A critical analysis of tiered pricing to improve access to medicines in developing countries" pptx

báo cáo khoa học: " A win-win solution?: A critical analysis of tiered pricing to improve access to medicines in developing countries" pptx

... widespread support as a win-win- win” approach to addressing access issues [9] However, evidence and experience suggest that, in practice, tiered pricing has a number of significant drawbacks Examining ... Hochstadt J, Bärnighausen T, Moon S: Intervening in global markets to improve access to HIV/AIDS treatment: An analysis of international policies and the dynam...

Ngày tải lên: 11/08/2014, 14:21

11 402 0
A critical analysis of environmental governance in urban china a case study of nanjing

A critical analysis of environmental governance in urban china a case study of nanjing

... by placing 12 collaborative planning an integral part of environmental governance in urban China, arguing that collaborative planning is a very promising form that will enable China to realize ... 138 iv Summary A CRITICAL ANALYSIS OF ENVIRONMENTAL GOVERNANCE IN URBAN CHINA: A CASE STUDY OF NANJING In the recent years, cities have emerged as the pri...

Ngày tải lên: 16/09/2015, 12:31

150 388 0
The lender of last resort a critical analysis of the federal reserve’s unprecedented intervention after 2007

The lender of last resort a critical analysis of the federal reserve’s unprecedented intervention after 2007

... them.) The high rate has the advantage of encouraging retention of the stock of the gold component of the monetary base at home as well as attracting additions to that stock from abroad And the ... Historical Federal Reserve data also are available on the FRED website maintained by the Federal Reserve Bank of St Louis See, also, a March 1936 pamphlet published...

Ngày tải lên: 23/09/2015, 08:53

101 287 0
Báo cáo sinh học: "A marginal quasi-likelihood approach to the analysis of Poisson variables with generalized linear mixed models" pot

Báo cáo sinh học: "A marginal quasi-likelihood approach to the analysis of Poisson variables with generalized linear mixed models" pot

... in [3], the quasi-likelihood approach only the specification of the marginal mean vector and of the variance requires 11 covariance matrix V of the vector Y of observations Given the moment generating ... estimates of fixed effects which resembles the so-called mixed model equations of Henderson (1984) The purpose of this note is to show how the GAR p...

Ngày tải lên: 14/08/2014, 19:22

7 274 0
A study of opening conversation on the phone in english and vietnamese

A study of opening conversation on the phone in english and vietnamese

... Representation of Telephone Openings in Vietnamese Like English, Conversation Openings in English and Vietnamese from 70 telephone conversations in Vietnamese and 40 questionares in Vietnamese, we can ... pragmatic aspects of telephone conversation openings on the basis of closing conversation on telephone 1.7 ORGANIZATION OF THE STUDY contrastive...

Ngày tải lên: 26/11/2013, 13:22

13 1,1K 2
A STUDY ON THE DIFFICULTIES IN STUDYING TOEIC READING OF NON ENGLISH MAJORS AT ELEMENTARY LEVEL AT HAIPHONG PRIVATE UNIVERSITY

A STUDY ON THE DIFFICULTIES IN STUDYING TOEIC READING OF NON ENGLISH MAJORS AT ELEMENTARY LEVEL AT HAIPHONG PRIVATE UNIVERSITY

... to focus on finding the difficulties in studying TOEIC Reading of non English majors at elementary level at Haiphong Private University and some implications while teaching and studying this ... Chapter 2: A study on the difficulties in studying TOEIC Reading of non- English majors students at elementary level at Haiphong...

Ngày tải lên: 11/12/2013, 23:53

58 1,5K 1
Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc

Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc

... GLU R1 5A forward (5¢-ATTCAAACTATAAAGTTGACGCAA CTGACTTGGAAACCTTC-3¢), GLU R1 5A reverse (5¢GAAGGTTTCCAAGTCAGTTGCGTCAACTTTATAGTT TGAAT-3¢); GLU H44 7A forward (5¢- GCAAGTCATTT TGGATGCTATTAATGATGATGGCTC-3¢), ... form any additional contacts with the molecule A 2164 Catalytic site The catalytic reaction of glucoamylases proceeds with inversion of configuration at the anom...

Ngày tải lên: 07/03/2014, 12:20

11 550 0
Báo cáo khoa học: Atrial natriuretic peptide-dependent photolabeling of a regulatory ATP-binding site on the natriuretic peptide receptor-A pptx

Báo cáo khoa học: Atrial natriuretic peptide-dependent photolabeling of a regulatory ATP-binding site on the natriuretic peptide receptor-A pptx

... co-digestion A synthetic linker (complementary oligonucleotides 5¢-TGAGCAACTCAAGAGA GGTGAAAGAGGCTCTTCTACACGTGGTTAAGGTA C-3¢ and 5¢-CTTAACCACGTGTAGAAGAGCCTCTTT CACCTCTCTTGAGTTGC-3¢) was ligated to ... of adenosine 5¢-triphosphate in the activation of membrane-bound guanylate cyclase by the atrial natriuretic factor FEBS Lett 219, 375–379 21 Marala RB, Sitaramayya A & Sharma RK...

Ngày tải lên: 16/03/2014, 23:20

12 338 0
Báo cáo toán học: " Spin-related tunneling through a nanostructured electric-magnetic barrier on the surface of a topological insulator" potx

Báo cáo toán học: " Spin-related tunneling through a nanostructured electric-magnetic barrier on the surface of a topological insulator" potx

... is natural to manipulate spin transport on the surface of a 3D topological insulator by controlling the electron orbital motion Based on the topological surface Hamiltonian, it is clear that σ ... In addition, changing the length of the barrier and/or the magnetic field can tune the total reflection and the perfect transmission regions We also examined the...

Ngày tải lên: 20/06/2014, 20:20

18 404 0
Báo cáo hóa học: " Video Waterscrambling: Towards a Video Protection Scheme Based on the Disturbance of Motion Vectors Yann Bodo" pdf

Báo cáo hóa học: " Video Waterscrambling: Towards a Video Protection Scheme Based on the Disturbance of Motion Vectors Yann Bodo" pdf

... domain In the second one, the authors embed the mark in the spatial domain The main advantage of the second approach is that it is able to embed more than 250 bits and to withstand stirmark attack ... Modification of motion vectors distribution after the application of the waterscrambling (a) Distribution of the x component (right) and y component (left) of the...

Ngày tải lên: 23/06/2014, 01:20

14 581 0
a return to love  reflections on the principles of a course in miracles

a return to love reflections on the principles of a course in miracles

... from A Course in Miracles Those passages with single quotation marks are paraphrased interpretations of that book A complete listing of citations to A Course in Miracles appears beginning on p ... I once read a delightful book called The Mists of Avalon The mists of Avalon are a mythical allusion to the tales of King Arthur Avalon is a magical isl...

Ngày tải lên: 04/07/2014, 15:17

169 1,1K 0
w