A correlation based method for direction finding of multipath signals in frequency hopping systems

A correlation based method for direction finding of multipath signals in frequency hopping systems

A correlation based method for direction finding of multipath signals in frequency hopping systems

... communication systems In smart antenna systems, the direction of users is an important factor to increase the capacity, and an antenna array is usually used at the base station to estimate and track ... hopping signals, and a new method is proposed to track multipath frequency hopping signals In Chapter 2, several popular methods for DOA estimation are addressed in...

Ngày tải lên: 15/09/2015, 22:51

89 337 0
Báo cáo y học: "Using the intervention mapping protocol to develop a community-based intervention for the prevention of childhood obesity in a multi-centre European project: the IDEFICS intervention" pptx

Báo cáo y học: "Using the intervention mapping protocol to develop a community-based intervention for the prevention of childhood obesity in a multi-centre European project: the IDEFICS intervention" pptx

... contrast to the sequence of intervention mapping steps, the evaluation design was already defined by the start of the European project The process evaluation was developed by the main coordinating ... during the second face -to- face meeting in November 2007 and finilised by the beginning of 2008 (Table 1) In January 2008, a central training was organised...

Ngày tải lên: 14/08/2014, 08:20

15 341 0
A capillary-based method determining the permeability of sand layer for geothermal applications

A capillary-based method determining the permeability of sand layer for geothermal applications

... role in the modelling of the heat transfer of BHEs in an aquifer for geothermal applications This paper presented a novel laboratory method determining the hydraulic permeability of sand layer using ... that, except for sand samples, the present method can also be applied for other porous materials with the grain diameter of 0.1-0.6 mm For porous...

Ngày tải lên: 05/09/2013, 17:03

8 450 0
Báo cáo hóa học: " A quantum dots and superparamagnetic nanoparticle-based method for the detection of HPV DNA" ppt

Báo cáo hóa học: " A quantum dots and superparamagnetic nanoparticle-based method for the detection of HPV DNA" ppt

... Capture probe 5-GAGGAGGATGAAATAGATGGTCCAGCTGG ACAAGCAGAACCGGACAGAGCCCATTACAATAT TGTAACCTTTTGTTGCAAGTGTGACTCT ACGCTTCGGT-3 Secondary probe 5-GGAGCGACCCAGAAAGTTACCACAGTTATGC ACAGAGCTGCAAACAACTA-3 ... on the basis of the cutoff value Detection of HPV- 16 with QDs and superparamagnetic nanoparticle-based hybridization The rationale of QDs and superparamagnetic nanopartic...

Ngày tải lên: 21/06/2014, 01:20

9 469 0
Báo cáo sinh học: "HuMiTar: A sequence-based method for prediction of human microRNA targets" ppt

Báo cáo sinh học: "HuMiTar: A sequence-based method for prediction of human microRNA targets" ppt

... authors read and approved all versions of the manuscript Additional material Additional File Supplement for article entitled "HuMiTar: A sequence-based method for prediction of human microRNA ... prediction for plants is easier than for animals [26,27]; and (2) identification of miR targets is critical to advancing understanding of human diseases, such as c...

Ngày tải lên: 12/08/2014, 17:20

12 621 0
Báo cáo sinh học: " A tree-based method for the rapid screening of chemical fingerprints" potx

Báo cáo sinh học: " A tree-based method for the rapid screening of chemical fingerprints" potx

... Multibit tree Again, a too large k will actually slow down the data Figure 11 Fraction of coefficients calculated, different database size The fraction of the database for which the Tanimoto coefficient ... bit In fact we only demand that the data is arranged in some binary tree The match-bits of a given node are computed as all bits that are not a match-bit in any a...

Ngày tải lên: 12/08/2014, 17:20

10 373 0
Development of a fluorescence correlation spectroscopy method for the study of biomolecular interactions

Development of a fluorescence correlation spectroscopy method for the study of biomolecular interactions

... products labeled with the same fluorescent dye, the only way of differentiating the product from the reactant is when the product has a molecular mass that differs from the reactants by at least a factor ... of the dual-color complexes formed This easily distinguishes the products from the free reactants via the amplitude of the CCF, as compared to the weak depe...

Ngày tải lên: 14/09/2015, 10:36

162 393 0
báo cáo hóa học:" Biomechanical testing of a polymer-based biomaterial for the restoration of spinal stability after nucleotomy" pptx

báo cáo hóa học:" Biomechanical testing of a polymer-based biomaterial for the restoration of spinal stability after nucleotomy" pptx

... performed by a standard microsurgical interlaminar approach Intradiscal implantation of the PGA-HA nucleus-implant as well as sealing of the annulus defect by sewing a PGA-HA annulus-implant ... biomechanical test set-up and advised in analyzing the data 14 ME advised about the use of biomaterials and customized the PGA-HA biomaterial 15 CK participated in the design...

Ngày tải lên: 20/06/2014, 04:20

9 457 0
A FUNCTIONAL-ANALYTIC METHOD FOR THE STUDY OF DIFFERENCE EQUATIONS EUGENIA N. PETROPOULOU AND potx

A FUNCTIONAL-ANALYTIC METHOD FOR THE STUDY OF DIFFERENCE EQUATIONS EUGENIA N. PETROPOULOU AND potx

... to study partial difference equations of three and four variables The aim of this paper is to present the generalization of this functional-analytic method for the study of linear and nonlinear ... to apply Theorem 1.1 to the preceding operator equation and obtain information for the initial linear difference equation under consideration In the case of...

Ngày tải lên: 23/06/2014, 00:20

12 257 0
Báo cáo lâm nghiệp: "A digital photographic method for 3D reconstruction of standing tree shape" ppt

Báo cáo lâm nghiệp: "A digital photographic method for 3D reconstruction of standing tree shape" ppt

... non-destructive estimate of the 3D profile for a large number of trees in the forest High resolution digital photographs are able to give fine details of the stem of trees, without the need for special illumination ... position of the standing trees The disadvantages of this method are that a minimum of three targets per log must be attached to the stem of standing...

Ngày tải lên: 07/08/2014, 16:21

7 451 0
Báo cáo y học: "A standardized scoring method for the copy of cube test, developed to be suitable for use in psychiatric populations" pdf

Báo cáo y học: "A standardized scoring method for the copy of cube test, developed to be suitable for use in psychiatric populations" pdf

... et al.: A standardized scoring method for the copy of cube test, developed to be suitable for use in psychiatric populations Annals of General Psychiatry 2011 10:19 Competing interests The authors ... been developed The aims of the current study were to develop a novel and detailed standardized method of administration and scoring of...

Ngày tải lên: 09/08/2014, 01:21

10 475 0
Báo cáo y học: "A consensus-based template for uniform reporting of data from pre-hospital advanced airway management" ppt

Báo cáo y học: "A consensus-based template for uniform reporting of data from pre-hospital advanced airway management" ppt

... the uniform reporting of data following a major trauma was published to simplify the comparison of data from different trauma registries [17] We believe that a similar template for the uniform reporting ... any airway management beyond manual opening of the airway and the use of simple adjuncts, such as a Guedel airway, should be considered as advanced airway...

Ngày tải lên: 13/08/2014, 23:21

14 265 0
Báo cáo sinh học: "A microsatellite-based analysis for the detection of selection on BTA1 and BTA20 in northern Eurasian cattle (Bos taurus) populations" doc

Báo cáo sinh học: "A microsatellite-based analysis for the detection of selection on BTA1 and BTA20 in northern Eurasian cattle (Bos taurus) populations" doc

... for the detection of selection on BTA1 and BTA20 in northern Eurasian cattle (Bos taurus) populations Genetics Selection Evolution 2010 42:32 Submit your next manuscript to BioMed Central and ... Estimation of the D′ metric for LD and tests for their significance were conducted only in three Finnish native breeds, i.e Northern Finncattle, East...

Ngày tải lên: 14/08/2014, 13:21

14 506 0
Báo cáo y học: "A classification based framework for quantitative description of large-scale microarray data" ppsx

Báo cáo y học: "A classification based framework for quantitative description of large-scale microarray data" ppsx

... results or reliability of classification techniques employed is yet to be seen Classification of unlabeled data based on a training set of query genes is the basis for many supervised classification ... stands for the number of states and pi corresponds to the probability of occurrence in state i An entropy value of stands for a state of high probability and that...

Ngày tải lên: 14/08/2014, 16:21

17 198 0
sensor based learning for practical planning of fine motion in robotics ppt

sensor based learning for practical planning of fine motion in robotics ppt

... Perception -based learning for motion in contact in task planning, Journal of Intelligent and Robotic Systems 17 (1996) 283–308 [21] T Kohonen, in: Self-Organizing Maps, Springer Series in Information ... steps required to perform a correct insertion and is expressed in terms of cost or negative reinforcement Sutton [22] defined reinforcement learning (RL) as the learni...

Ngày tải lên: 28/03/2014, 14:20

22 482 0
w