A chemical genetics approach to identify targets essential for the viability of mycobacteria
A chemical genetics approach to identify targets essential for the viability of mycobacteria
... A CHEMICAL GENETICS APPROACH TO IDENTIFY TARGETS ESSENTIAL FOR THE VIABILITY OF MYCOBACTERIA STEPHEN HSUEH-JENG LU (B.Sc (Hons.), University of Auckland) A THESIS SUBMITTED FOR THE DEGREE OF ... eradicate both populations The only feasible way to elucidate such a novel target is to use a forward chemical genetics approach Forward chemical genetics involves screening a library of compounds ... Technologies available for identification of drug targets The identification of the biological target of a compound has several advantages for drug development Critically, a known drug target would allow...
- 109
- 254
- 0
Báo cáo hóa học: " Our vision for this new SpringerOpen Access journal, Psychology of Well-Being: Research, Theory and Practice, is to promote a distinctly eclectic approach to investigating well-being. When the prospect of " pdf
... dedicated to well-being research, many of whom we are fortunate to have on our editorial board Several of the major achievements occurring over the past decade were facilitated by the formation of “positive ... journal but we feel the research climate and resources are now supportive of these types of challenges Well-being research has increased substantially over the past decade and the demand to disseminate ... have subsequently employed an online, open access format This means that the end users will now also be able to read Page of Vella-Brodrick and Rickard Psychology of Well-Being: Theory, Research...
- 3
- 432
- 0
Báo cáo y học: "A genome-wide approach to identify genetic loci with a signature of natural selection in the Irish population" pps
... common alleles ranging in frequency from 27% to 23% (Additional data file 2) Tryptases have been implicated as mediators in the pathogenesis of asthma and other allergic and inflammatory disorders ... is an assessment of allele frequency spectra within a single group To empirically assess the potential complementarity of these approaches, we took a data set composed of 377 microsatellite markers ... has not been confounded by demographic processes in the Irish population In addition to the demonstrated utility in detecting a signature of natural selection, this approach has the particular...
- 9
- 456
- 0
Strategic thinking: A nine step approach to strategy and leadership for managers and marketers
... organizations, and by managers of large multinational companies and international NGOs It is popular with final-year undergraduates and MBA and Master's students of business, management and marketing ... book is an all-in-one-place handbook for those managers and members of the marketing team who need to collect and assess information, create and communicate market-led strategies, take strategic ... this book I'ART I STRATEGIC LEADERSHIP ction Strategic leadership Strategic leadership and conversational style ction Strategic leadership - brain-based communication ction Strategic leadership...
- 159
- 1,243
- 0
Báo cáo khoa học: "A Word-Class Approach to Labeling PSCFG Rules for Machine Translation" pot
... labeling phrase pairs to create automatically learned PSCFG rules for machine translation Crucially, our methods only rely on “shallow” lexical tags, either generated by POS taggers or by automatic ... unsupervised clustering approaches, we first need to decide how to determine the number of word classes, N A straightforward approach is to run experiments and report test set results for many different ... grammar rules decreases the reliability of estimated models for rare events due to increased data sparseness Given the same phrase extraction method as before, the resulting initial rules for our...
- 11
- 424
- 0
Báo cáo hóa học: " A Low-Complexity Approach to Space-Time Coding for Multipath Fading Channels" ppt
... transmit antenna to the receive antenna is formed by a pulse-shaping transmit filter (e.g., a root-raised cosine pulse [3]), a multipath fading channel with P separable paths, an ideal lowpass ... low-complexity decoding scheme can be seen as a practical version of this asymptotically optimal scheme and differs in two key aspects that make it practical: (1) it uses a very short interleaving ... signal constellation [15] Since the constellation size has no impact on the decoder complexity, variable-rate (adaptive) modulation can be easily implemented This fact has particular relevance...
- 10
- 270
- 0
Báo cáo y học: "Comparison of a Two-Lead, Computerized, Resting ECG Signal Analysis Device, the MultiFunction-CardioGramsm or MCG (a.k.a. 3DMP), to Quantitative Coronary Angiography for the Detection of Relevant Coronary Artery Stenosis (70%)
... Coronary angiography remains the gold standard for the morphologic diagnosis of CAD and also allows revascularization during the same procedure [12, 13] Coronary angiography is a relatively safe and ... Combined Analysis Total USA Asia Germany female male < 65 years 65+ years Female, < 65 years Female, 65+ years Male, < 65 years Male, 65+ years No Revasc PCI CABG Revasc of any type ROC AUC Odds Ratio ... in this meta -analysis was not to study MCG as a screening device, but instead to focus primarily on its potential as a diagnostic assay for relevant coronary stenosis Resting ECG analysis, including...
- 13
- 684
- 0
A study on using visual aids to teach ESP vocabulary for the students of the Shipbuilding Faculty at the Central Vocational College of Transport NoII sử dụng
... situation of using visual aids to teach ESP vocabulary at the Central Vocational College of Transport No.II ● Exploring the difficulties facing teachers and students in teaching and learning ESP ... observation to collect data The data for the study came from two sources: teacher respondents and student respondents at the Central Vocational College of Transport No.II Classroom observation was ... literature on some basic concepts related to ESP, vocabulary, ESP vocabulary and visual aids Besides, the issue of teaching vocabulary and the benefits of using visual aids to teach vocabulary are presented...
- 53
- 1,449
- 5
Co-operative learning as an approach to improving speaking skills for the second-year non-major students of English at Hanoi University of Business and Technolo
... decided to narrow the topic of the research to Co-operative learning as an approach to improving speaking skills for the second-year non-major students of English at Hanoi University of Business ... researcher to propose “Cooperative learning as an approach to improving speaking skills for the second-year nonmajor students of English at Hanoi University of Business and Technology” as the subject of ... Thus, the first and foremost objective of the study is for the sake of the students at Hanoi University of Business and Technology, where the researcher worked as a teacher of English Although any...
- 83
- 1,025
- 2
A study on how to enrich english vocabulary for the first year english major students at ha noi pedagogical university no 2
... vocabulary for the first- year English major students at Hanoi Pedagogical University N0 .2. ” II Aim of the Study The ultimate goal of the study is to help the first- year English major students to establish ... phenomenon is strategies for learning vocabulary made by the first- year students of English of Foreign Language Faculty at HPU2 in the academic year of 20 12/ 2013 Others relating to vocabulary are also ... study on how to enrich English vocabulary for the first- year English major students at Hanoi Pedagogical University N0 .2 (Graduation paper submitted in partial fulfillment of the Degree of Bachelor...
- 48
- 1,151
- 1
Báo cáo hóa học: " A quantum dots and superparamagnetic nanoparticle-based method for the detection of HPV DNA" ppt
... Capture probe 5-GAGGAGGATGAAATAGATGGTCCAGCTGG ACAAGCAGAACCGGACAGAGCCCATTACAATAT TGTAACCTTTTGTTGCAAGTGTGACTCT ACGCTTCGGT-3 Secondary probe 5-GGAGCGACCCAGAAAGTTACCACAGTTATGC ACAGAGCTGCAAACAACTA-3 ... on the basis of the cutoff value Detection of HPV- 16 with QDs and superparamagnetic nanoparticle-based hybridization The rationale of QDs and superparamagnetic nanoparticle-based hybridization ... separation and diagnosis, the superparamagnetic nanoparticle has a unique advantage over others Herein, we report a novel detection method of HPV DNA combining the advantages of QDs and manipulability...
- 9
- 469
- 0
Báo cáo khoa học: "Development of a Lightcycler-based reverse transcription polymerase chain reaction for the detection of foot-and-mouth disease virus" pps
... emaN ecneuqeS eborP esreveR drawroF eborP esreveR drawroF eborP esreveR drawroF '3-pxGCCAATTTCAGCCCAGGCACAAAm-'5 '3-TYCGGTTYGGGACCATGTT-'5 '3-AACTGTACAGRAGGACGTAGA-'5 '3-TAGCGCATGGTGGGCAACCTCCA-'5 ... 55/lizarb/oriezurc/4 2A rof ecneuqes ehT sniarts 21 eht rof dezylana saw noiger tegrat ehT )ASU ,ratsanD( erawtfos ratsanD eht gnisu dengila dna )1 elbaT( A C aisA 2TAS O O O O O O O O 55/lizarB/oriezurC/4 2A ... '3-TAGCGCATGGTGGGCAACCTCCA-'5 '3-CTGAARATGGGKACCTGCG-'5 '3-GTSCGYTTSTGYCGCACAA-'5 '3-px CCATGGACTTCCCGTAGGAATCGGACAm-'5 '3-CCATTGTRCGCTGTGAGC-'5 '3-CACGACCCCAACGTGTGT-'5 B2 redaeL SERI noigeR seborp dna sremirp cificeps-VDMF...
- 6
- 347
- 0
báo cáo khoa học: "Transient myeloproliferative disorder in a newborn with Down Syndrome treated with rasburicase for the risk of development of tumor lysis syndrome: A case report" doc
... biochemistry and coagulation test values on day four (initiation of rasburicase) and 10 (end of rasburicase administration) are shown in Table Peripheral blasts disappeared by day eight after the initiation ... patient’s treatment and care as well as for the writing and revision of the manuscript All authors contributed equally to the final draft of the manuscript, and read and approved the final manuscript ... rasburicase for the risk of development of tumor lysis syndrome: A case report Journal of Medical Case Reports 2011 5:407 Consent Written informed consent was obtained from the patient’s next -of- kin for...
- 3
- 316
- 0
Từ khóa: a zinc ribbon motif is essential for the formation of functional tetrameric protein kinase ck2open sky anterior approach müller s muscle resection for the correction of blepharoptosisalternatives to hypochlorite washing systems for the decontamination of fresh fruit and vegetablesa general approach to identify novel viral genestowards a unified approach to memorya feature based approach to leveraging contextdistributed listening a parallel processing approach to automatica novel featurebased approach to chinesea unified tagging approach to text normalizationa rule based approach to temporal expression tagginga rule based approach to group recommender systemsa rule based approach to activity recognitiona rule based approach to discourse parsinga rule based approach to image retrievala rule based approach to the trim loss problemNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ