A chemical genetics approach to identify targets essential for the viability of mycobacteria
... A CHEMICAL GENETICS APPROACH TO IDENTIFY TARGETS ESSENTIAL FOR THE VIABILITY OF MYCOBACTERIA STEPHEN HSUEH-JENG LU (B.Sc (Hons.), University of Auckland) A THESIS SUBMITTED FOR THE DEGREE OF ... eradicate both populations The only feasible way to elucidate such a novel target is to use a forward chemical genetics approach Forward chemical...
Ngày tải lên: 15/09/2015, 22:51
... dedicated to well-being research, many of whom we are fortunate to have on our editorial board Several of the major achievements occurring over the past decade were facilitated by the formation of “positive ... journal but we feel the research climate and resources are now supportive of these types of challenges Well-being research has increased substantially over...
Ngày tải lên: 21/06/2014, 06:20
... common alleles ranging in frequency from 27% to 23% (Additional data file 2) Tryptases have been implicated as mediators in the pathogenesis of asthma and other allergic and inflammatory disorders ... is an assessment of allele frequency spectra within a single group To empirically assess the potential complementarity of these approaches, we took a data set composed of...
Ngày tải lên: 14/08/2014, 17:22
Strategic thinking: A nine step approach to strategy and leadership for managers and marketers
... organizations, and by managers of large multinational companies and international NGOs It is popular with final-year undergraduates and MBA and Master's students of business, management and marketing ... book is an all-in-one-place handbook for those managers and members of the marketing team who need to collect and assess information, create and communicate market-led...
Ngày tải lên: 15/03/2014, 15:33
Báo cáo khoa học: "A Word-Class Approach to Labeling PSCFG Rules for Machine Translation" pot
... labeling phrase pairs to create automatically learned PSCFG rules for machine translation Crucially, our methods only rely on “shallow” lexical tags, either generated by POS taggers or by automatic ... unsupervised clustering approaches, we first need to decide how to determine the number of word classes, N A straightforward approach is to run experiments and report test se...
Ngày tải lên: 23/03/2014, 16:20
Báo cáo hóa học: " A Low-Complexity Approach to Space-Time Coding for Multipath Fading Channels" ppt
... transmit antenna to the receive antenna is formed by a pulse-shaping transmit filter (e.g., a root-raised cosine pulse [3]), a multipath fading channel with P separable paths, an ideal lowpass ... low-complexity decoding scheme can be seen as a practical version of this asymptotically optimal scheme and differs in two key aspects that make it practical: (1) it uses a very shor...
Ngày tải lên: 23/06/2014, 00:20
Báo cáo y học: "Comparison of a Two-Lead, Computerized, Resting ECG Signal Analysis Device, the MultiFunction-CardioGramsm or MCG (a.k.a. 3DMP), to Quantitative Coronary Angiography for the Detection of Relevant Coronary Artery Stenosis (70%)
... Coronary angiography remains the gold standard for the morphologic diagnosis of CAD and also allows revascularization during the same procedure [12, 13] Coronary angiography is a relatively safe and ... Combined Analysis Total USA Asia Germany female male < 65 years 65+ years Female, < 65 years Female, 65+ years Male, < 65 years Male, 65+ years No Revasc PCI CABG Revasc...
Ngày tải lên: 03/11/2012, 10:58
A study on how to enrich English vocabulary for the first year English major students at Ha noi Pedagogical University No.2
Ngày tải lên: 06/10/2014, 15:12
A study on using visual aids to teach ESP vocabulary for the students of the Shipbuilding Faculty at the Central Vocational College of Transport NoII sử dụng
... situation of using visual aids to teach ESP vocabulary at the Central Vocational College of Transport No.II ● Exploring the difficulties facing teachers and students in teaching and learning ESP ... observation to collect data The data for the study came from two sources: teacher respondents and student respondents at the Central Vocational...
Ngày tải lên: 28/03/2015, 08:54
Co-operative learning as an approach to improving speaking skills for the second-year non-major students of English at Hanoi University of Business and Technolo
... decided to narrow the topic of the research to Co-operative learning as an approach to improving speaking skills for the second-year non-major students of English at Hanoi University of Business ... researcher to propose “Cooperative learning as an approach to improving speaking skills for the second-year nonmajor stu...
Ngày tải lên: 28/03/2015, 09:41
A study on how to enrich english vocabulary for the first year english major students at ha noi pedagogical university no 2
... vocabulary for the first- year English major students at Hanoi Pedagogical University N0 .2. ” II Aim of the Study The ultimate goal of the study is to help the first- year English major students to establish ... phenomenon is strategies for learning vocabulary made by the first- year students of English of Foreign Language Faculty a...
Ngày tải lên: 30/11/2015, 09:10
Báo cáo hóa học: " A quantum dots and superparamagnetic nanoparticle-based method for the detection of HPV DNA" ppt
... Capture probe 5-GAGGAGGATGAAATAGATGGTCCAGCTGG ACAAGCAGAACCGGACAGAGCCCATTACAATAT TGTAACCTTTTGTTGCAAGTGTGACTCT ACGCTTCGGT-3 Secondary probe 5-GGAGCGACCCAGAAAGTTACCACAGTTATGC ACAGAGCTGCAAACAACTA-3 ... on the basis of the cutoff value Detection of HPV- 16 with QDs and superparamagnetic nanoparticle-based hybridization The rationale of QDs and superparamagnetic nanopartic...
Ngày tải lên: 21/06/2014, 01:20
Báo cáo khoa học: "Development of a Lightcycler-based reverse transcription polymerase chain reaction for the detection of foot-and-mouth disease virus" pps
... emaN ecneuqeS eborP esreveR drawroF eborP esreveR drawroF eborP esreveR drawroF '3-pxGCCAATTTCAGCCCAGGCACAAAm-'5 '3-TYCGGTTYGGGACCATGTT-'5 '3-AACTGTACAGRAGGACGTAGA-'5 '3-TAGCGCATGGTGGGCAACCTCCA-'5 ... 55/lizarb/oriezurc/4 2A rof ecneuqes ehT sniarts 21 eht rof dezylana saw noiger tegrat ehT )ASU ,ratsanD( erawtfos ratsanD eht gnisu dengila dna )1 elbaT( A C aisA 2TAS O O O O O O O O 55/liz...
Ngày tải lên: 07/08/2014, 18:21
báo cáo khoa học: "Transient myeloproliferative disorder in a newborn with Down Syndrome treated with rasburicase for the risk of development of tumor lysis syndrome: A case report" doc
... biochemistry and coagulation test values on day four (initiation of rasburicase) and 10 (end of rasburicase administration) are shown in Table Peripheral blasts disappeared by day eight after the initiation ... patient’s treatment and care as well as for the writing and revision of the manuscript All authors contributed equally to the final draft of the manuscript, an...
Ngày tải lên: 10/08/2014, 23:20