Autocrine growth hormone (hGH) and chemotherapeutic drug resistance in mammary carcinoma cells 1
Ngày tải lên: 15/09/2015, 21:28
... compartment……………… 28 2. 6 GH and mammary carcinoma ………………………………………………31 2. 6.1 GH/IGF-1 axis and mammary carcinoma ………………………….31 2. 6 .2 IGF-independent effect of GH in mammary carcinoma …………. 32 2.7 Balance ... mitogen-activated protein kinase (MAPK) pathway …………………………………………………………………………… 22 2. 5 GH and mammary gland…………………………………………………… 26 2. 5.1 GH regulation of...
Ngày tải lên: 15/09/2015, 21:28
... of autocrine hGH in mammary carcinoma cells a Analyzing the effect of autocrine hGH on apoptotic proteins: Bcl-2, Bclxl, Bak, Bax, p 53 at protein level by Western Blot in mammary carcinoma cells ... Blot in mammary carcinoma cells respectively b Analyzing the contribution of induced catalase expression by autocrine hGH to the protective effect of autocrine hG...
Ngày tải lên: 16/09/2015, 08:29
Báo cáo khoa học: Inhibition of PI3K/Akt partially leads to the inhibition of PrPC-induced drug resistance in gastric cancer cells pdf
... of PrPC-induced cell drug resistance in gastric cancer cells PI3K/Akt is involved in the activation of P-gp by PrPC in gastric cancer To further investigate the underlying mechanism of PI3K/Akt- mediated ... significantly increased The results indicate that inhibition of the PI3K/Akt signaling pathway may lead to inhibition of the MDR indu...
Ngày tải lên: 07/03/2014, 03:20
Báo cáo y học: "Diurnal secretion of growth hormone, cortisol, and dehydroepiandrosterone in pre- and perimenopausal women with active rheumatoid arthritis: a pilot case-control study" ppt
... data analysis and in drafting this manuscript RM participated in data analysis and in drafting this manuscript MW and BEM participated in all patient recruiting and management HLB and KAW participated ... between patients with RA and control subjects Patients with RA were predominantly Hispanic-American and African-American, whereas control subjects were primarily Ca...
Ngày tải lên: 09/08/2014, 10:20
Báo cáo y học: " Effectiveness of antiretroviral therapy and development of drug resistance in HIV-1 infected patients in Mombasa, Kenya" doc
... laboratory facilities for treatment monitoring in these patients however are running behind A random sample survey is often the only way to assess treatment efficacy and the selection of drug resistance ... Survey 2007 Nairobi Kenya: National AIDS and STI Control Programme, Ministry of Health Kenya (NASCOP); 2008 Guidelines for Antiretroviral Drug Therapy in Kenya 3rd...
Ngày tải lên: 10/08/2014, 05:21
báo cáo khoa học: " Down-regulation of miR-27a might inhibit proliferation and drug resistance of gastric cancer cells" docx
... 1D), suggesting that down-regulation of miR-27a might inhibit the growth of MKN45 cells in vitro and in vivo Down-regulation of miR-27a might reverse drug resistance of gastric cancer cells As shown ... down-regulation of miR-27a might inhibit proliferation and drug resistance of gastric cancer cells through regulation of P-gp, cyclin...
Ngày tải lên: 10/08/2014, 10:21
Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt
... CTGCGGTGCTGTTGTGG CACCATCATAAGGGTAAACAT ACAGCAAAAAGGAGGCCAAA GCCACAATCCAGTCATTCCA GATAAGCTTGTGGAAGTCGCGT TCTCACTGGCCCTAAACTGG CTGATAGGGGTTGGGTGATG GCATTTCCATTTCCCTAAGCAC CAACACAATCCTGAGGCACA TCCCTTTGCCTCCTGTTGTT ... CGGAAACGCCTTAAGTCCAG AATAAGCTTCCGACTCTAGCCGC AGCTGGTGCAGGAGGAAGTA CCGAGAACCGAACTTACCAA AGGAAGCACCCAGCAATACCA CACCTTGGATGGGTATTCCA CACAGCTCCCATTCATTCCA TCCTCCCTGGAGAAGAGCTA CTCCTGG...
Ngày tải lên: 06/03/2014, 22:21
Patterns of drug resistance in pulmonary tuberculosis cases in the Izmir district, Turkey pdf
... triple and quadruple resistance instead of notifying the incidence of plain resistance rates, in the new and the previously treated cases in the Izmir district METHODS Setting The study was carried ... indicated as total resistance for a drug with and without accompanying other drug resistance Polydrug resistance is resistance of M tuberculosis strain...
Ngày tải lên: 29/03/2014, 03:20
Báo cáo lâm nghiệp: "Growth dynamics, transpiration and water-use efficiency in Quercus robur plants submitted to elevated CO 2 and drought " pdf
... observed on d2 42, d244, d286, but not on d204, d216, d238 and d2 72 With was Under the droughted conditions, A was significantly stimulated in the elevated [CO ] treatment only on d244, while no ... (d 320 ) was reduced by drought by about 10% in both [CO but was not affected by [CO ], ] (table II) d2 72 and d286, g lower in the elevated [CO than in the ] ambient [CO...
Ngày tải lên: 08/08/2014, 18:21
Báo cáo khoa học: "gelling agents on growth, mineral composition and naphthoquinone content of in vitro explants of hybrid walnut tree (Juglans regia x Juglans nigra)" pdf
... was gelling agents Mineral content of leaves The gelling agents presented major differences in mineral content (table II) Gelrite contained a higher amount of Ca and Mg and K (4-fold) and Fe than ... micropropagation of an embryonic axis of hybrid walnut (Juglans regia x Juglans nigra) according to the technique described by Jay-Allemand and Cornu (...
Ngày tải lên: 08/08/2014, 23:22
Báo cáo khoa học: "Growth, gas exchange and carbon isotope discrimination in young Prunus avium trees growing with or without individual lateral shelters" doc
... accompanying vegetation without any below-ground relationship - on young Prunus avium trees Measurements of: 1) microclimatic parameters ; 2) growth ; 3) leaf gas exchange ; and 4) leaf carbon isotope ... exchange parame- ters A and g were highest for leaf order between and All gas exchange data reported hereafter correspond to measurements made within that zone...
Ngày tải lên: 08/08/2014, 23:22
Báo cáo y học: "Adipose-derived mesenchymal stem cells from the sand rat: transforming growth factor beta and 3D co-culture with human disc cells stimulate proteoglycan and collagen type I rich extracellular matrix" ppsx
... antibodies used in 3D immunohistological and CD marker studies Antibody Source Dilution Type I collagen Biodesign International (Kennebunk, ME) 20 μg/ml Type II collagen Biodesign International (Kennebunk, ... dimensional; CD, cluster of differentiation plastic adherence and lineage specific differentiation satisfy the standard criteria suggested for defining mesenchymal...
Ngày tải lên: 09/08/2014, 10:23
Báo cáo y học: "Suppressing miRNA-15a/-16 expression by interleukin-6 enhances drug-resistance in myeloma cells" ppt
... kidney disease J Clin Invest 2008, 118:3714-3724 doi:10.1186/1756-8722-4-37 Cite this article as: Hao et al.: Suppressing miRNA-15a/-16 expression by interleukin-6 enhances drug-resistance in myeloma ... expression in MM cells (A) MM-BMSCs inhibited apoptosis of MM cells induced by cytotoxic agent (B) Stem-loop RT-PCR assay showed that miRNA-15a/16 expression in MM c...
Ngày tải lên: 10/08/2014, 21:23
báo cáo khoa học: "Development of PEGylated PLGA nanoparticle for controlled and sustained drug delivery in cystic fibrosis" pptx
... = 100 μm intranasal drug delivery helps in improving the efficacy of drug by assisting in its lung delivery and biodistribution The PLGA- PEGPS341 provides controlled and targeted drug delivery ... drug- delivery therapeutics for CF and other airway diseases like COPD and asthma The nanodrug delivery system here provides controlled and sustained PS-34...
Ngày tải lên: 11/08/2014, 00:22