Acceptability, safety and contraceptive efficacy of a new single rod subdermal 3 ketodesogestrel implant in singaporean women acceptors

Acceptability, safety and contraceptive efficacy of a new single rod subdermal 3 ketodesogestrel implant in singaporean women acceptors

Acceptability, safety and contraceptive efficacy of a new single rod subdermal 3 ketodesogestrel implant in singaporean women acceptors

... Biotransformation and pharmacokinetics of desogestrel / 3- ketodesogestrel (d) Drug safety (e) Clinical data Synopsis IMPLANON™ is a new single- rod subdermal contraceptive implant containing a relatively ... fetal development, labour and delivery, lactation, neonatal viability and growth of the newborn (perinatal and postnatal studies) In the teratologic, pe...

Ngày tải lên: 15/09/2015, 21:09

265 291 0
Báo cáo y học: " G-CSF and IL-8 for early diagnosis of sepsis in neonates and critically ill children – safety and cost effectiveness of a new laboratory prediction model: study protocol of a randomized controlled trial [ISRCTN91123847]" pps

Báo cáo y học: " G-CSF and IL-8 for early diagnosis of sepsis in neonates and critically ill children – safety and cost effectiveness of a new laboratory prediction model: study protocol of a randomized controlled trial [ISRCTN91123847]" pps

... hospital's database This database contains all physician's reports, patient baseline data, routine laboratory results, pharmacology data, costs per R446 patient and day of specific medications ... plasma measurements of IL-8 and G-CSF and tracheal aspirate levels of G-CSF, employing a new laboratory method that allows simultaneous determination of parameters from 50...

Ngày tải lên: 12/08/2014, 20:20

8 407 0
Báo cáo khoa học: "The Safety and efficacy of a new self-expandable intratracheal nitinol stent for the tracheal collapse in dogs" ppt

Báo cáo khoa học: "The Safety and efficacy of a new self-expandable intratracheal nitinol stent for the tracheal collapse in dogs" ppt

... (b) intratracheal placement of self expandable nitinol stent with flare ends in a dog with tracheal collapse Collapsed trachea is extended and sustained (white arrow) Intratracheal nitinol stent ... treatment of tracheal collapse in a dog J Am Vet Med Assoc 2004, 225, 1217-1221 10 Moritz A, Schneider M, Bauer N Management of advanced tracheal collapse...

Ngày tải lên: 07/08/2014, 20:23

3 576 0
Báo cáo khoa học: Characterization and structural modeling of a new type of thermostable esterase from Thermotoga maritima ppt

Báo cáo khoa học: Characterization and structural modeling of a new type of thermostable esterase from Thermotoga maritima ppt

... between archaea and bacteria from genome sequence of Thermotoga maritima Nature 399, 323–329 Lim D & Strynadka A (2002) Structural basis for the b-lactam resistance of PBP 2a from methicillin-resistant ... triad, consisting of a serine in a New thermostable esterase from Thermotoga maritima GXSXG pentapeptide, an acidic aspartate, and a histidine resid...

Ngày tải lên: 23/03/2014, 09:20

11 461 0
Báo cáo y học: "Childhood adversity, mental ill-health and aggressive behavior in an African orphanage: Changes in response to trauma-focused therapy and the implementation of a new instructional system" ppt

Báo cáo y học: "Childhood adversity, mental ill-health and aggressive behavior in an African orphanage: Changes in response to trauma-focused therapy and the implementation of a new instructional system" ppt

... article as: Hermenau et al.: Childhood adversity, mental illhealth and aggressive behavior in an African orphanage: Changes in response to trauma-focused therapy and the implementation of a new instructional ... (range - 16) at t1 and M = 9.16 years (range - 16) at t2 The Tanzanian and German board of the organization managing the orphan...

Ngày tải lên: 13/08/2014, 18:22

9 405 0
Feasibility investigation and combustion enhancement of a new burner functioning with pulverized solid olive waste

Feasibility investigation and combustion enhancement of a new burner functioning with pulverized solid olive waste

... cake and 75 wt% coal mixture is combusted with a primary excess air of 70% and a secondary air mass flow of 40L/min Abu-Qudais and Okasha [5] have realized an important experimental study of the ... thermal systems, heat and mass transfer in porous media and combustion Prof Abdallah has published a number of papers in internationalJournals and conference proceedi...

Ngày tải lên: 09/09/2015, 10:32

10 245 0
Báo cáo Y học: Molecular and biochemical characteristics of a gene encoding an alcohol acyl-transferase involved in the generation of aroma volatile esters during melon ripening pptx

Báo cáo Y học: Molecular and biochemical characteristics of a gene encoding an alcohol acyl-transferase involved in the generation of aroma volatile esters during melon ripening pptx

... hypersensitivity-related proteins of Arabidopsis and tobacco; and (b) acyl transferases such as anthranilate N-hydroxy-cinnamoyl/benzoyl-transferase (NHCBT)-like protein of Arabidopsis and Dianthus caryophyllus, ... strawberry [9] and yeast AATs [33] CMAAT1 was capable of accepting branched alcohols such as 2- and 3-methylbutyl alcohol (also named amyl and isoamyl alcohols...

Ngày tải lên: 31/03/2014, 21:21

8 510 0
Identification of a new tumor suppressor pathway modulating rapamycin sensitivity in colorectal cancer

Identification of a new tumor suppressor pathway modulating rapamycin sensitivity in colorectal cancer

... 3' ATGGAGGAGGACATTGATACC 3' ACATTGTATTCACCCCTACG 3' ATACGCCAGTGACGACCAGAGC 3' TAGCCCACACCATGAAAGCG 3' ATGGGAAGGTGAAGGTCGG 3' AAGACGCCAGTGGACTCCACGA 3' GTGGGGCGCCCCAGGCACCA 3' CTCCTTAATGTCACGCACGATTTC ... 3' AGTGGGCTGCGCGTCTCATTTTC 3' AAGGGTTCGTGGAGCATGGG 3' ATGGTTGCAACTGGCAGTTTG 3' AGGACCTTTGAGCAACCAAG 3' AACGGCAGCGCCTTCTTGCT 3' GGCCCATGACCAGATCAGCA 3' ATGAGCTGCACCAGAATGATCC 3' TTGGTTGTGTGAGC...

Ngày tải lên: 09/09/2015, 18:52

200 331 0
Báo cáo y học: " Safety and efficacy of a generic fixed-dose combination of stavudine, lamivudine and nevirapine antiretroviral therapy between HIV-infected patients with baseline CD4 " pot

Báo cáo y học: " Safety and efficacy of a generic fixed-dose combination of stavudine, lamivudine and nevirapine antiretroviral therapy between HIV-infected patients with baseline CD4 " pot

... Anekthananon T, Ratanasuwan W, Techasathit W, Sonjai A, Suwanagool S: Safety and efficacy of a simplified fixed-dose combination of stavudine, lamivudine and nevirapine (GPO-VIR) for the treatment ... W, Kiatatchasai W, Vibhagool A: Initiation of highly active antiretroviral therapy in advanced AIDS with CD4 < 50 cells/mm3 in a resourcelimited setting: e...

Ngày tải lên: 10/08/2014, 05:20

8 371 0
Tài liệu Báo cáo khoa học: Identification, sequencing, and localization of a new carbonic anhydrase transcript from the hydrothermal vent tubeworm Riftia pachyptila docx

Tài liệu Báo cáo khoa học: Identification, sequencing, and localization of a new carbonic anhydrase transcript from the hydrothermal vent tubeworm Riftia pachyptila docx

... 757–778 AAG AGC GCA ACT GAT AGT GCA TCC GCC ATC GAC GCA ATT AGC CTT GCT AGC AGT ACG AGG 613–630 822–839 706–723 466–483 AAG AGC AAA GAT GAT AGT GAT TAC GCC ATC CCA CAG ATT AGC ATC AAT AGC AGT CAG ... The fact that several genes can be the source of several isoforms in the branchial plume could increase global carbonic anhydrase activity Carbonic anhydrase transcripts in Rifti...

Ngày tải lên: 18/02/2014, 16:20

14 591 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

... GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter The PCR products ... functions and intracellular signaling Thus, our system provides an accessible method to examine the endothelial cell biology of the mouse, and will accelerat...

Ngày tải lên: 18/02/2014, 17:20

11 874 0
Báo cáo khoa học: Synthesis and characterization of a new and radiolabeled high-affinity substrate for H+/peptide cotransporters pdf

Báo cáo khoa học: Synthesis and characterization of a new and radiolabeled high-affinity substrate for H+/peptide cotransporters pdf

... sub5910 strates of H+ ⁄ peptide cotransporters, such as Gly-Sar, Ala-Ala, Lys-Lys, Ala-Asp, d-Phe-Ala, Ala-Ala-Ala, d-aminolevulinic acid, cefadroxil and Ala-4-nitroanilide (all 100 lm, Table 1) ... UK) Dexamethasone, apotransferrin, Gly-Gln, AlaAla, Ala-Ala-Ala, Lys-Lys, d-aminolevulinic acid, cefadroxil, Gly, Pro-Ala, 8-aminooctanoic acid and Gly-Sar were from Sigma-Aldrich (Deisenho...

Ngày tải lên: 07/03/2014, 05:20

10 490 0
Báo cáo khoa học: Purification and properties of a new S-adenosyl-Lmethionine:flavonoid 4¢-O-methyltransferase from carnation (Dianthus caryophyllus L.) pot

Báo cáo khoa học: Purification and properties of a new S-adenosyl-Lmethionine:flavonoid 4¢-O-methyltransferase from carnation (Dianthus caryophyllus L.) pot

... was a mixture of 0.05 M NaPi buffer, pH 3, and acetonitrile (6 : 1, v/v); separation was performed isocratically, at a flow rate of mLÆmin)1, and the volume of injected samples was 10 lL The amounts ... concentration of both the assayed compound and its respective transformation product was determined by comparison of peak data with those obtained from authentic standards...

Ngày tải lên: 08/03/2014, 08:20

10 624 0
w