Cu(II) and Ni(II) complexes of n (2 hydroxybenzyl) amino acid ligands synthesis, structures, properties and catecholase activity 2

Cu(II) and Ni(II) complexes of n (2 hydroxybenzyl) amino acid ligands  synthesis, structures, properties and catecholase activity 4

Cu(II) and Ni(II) complexes of n (2 hydroxybenzyl) amino acid ligands synthesis, structures, properties and catecholase activity 4

... 2.051 (4) Ni(1) -N( 1) 2.0 84( 4) Ni(1)-O(1) 2.089 (4) Ni(2)-O( 14) 2.039 (4) Ni(2)-O(7) 2. 042 (4) Ni(2)-O(5)a 2. 048 (4) Ni(2)-O(13) 2.070(3) Ni(2)-O(6) 2.101(3) O(5)-Ni(2)b 2. 048 (4) O( 14) -Ni(2)-O(5)a 89. 4( 2) ... oxygen atom (Ni(1)-O(2), 2. 047 (4) Å and Ni(2)O(7), 2. 042 (4) Å) in a facial manner, two aqua ligands and another carboxylate oxygen from the neighboring molecule Sel...

Ngày tải lên: 15/09/2015, 17:10

22 216 0
Cu(II) and Ni(II) complexes of n (2 hydroxybenzyl) amino acid ligands  synthesis, structures, properties and catecholase activity 3

Cu(II) and Ni(II) complexes of n (2 hydroxybenzyl) amino acid ligands synthesis, structures, properties and catecholase activity 3

... C12H17NNiO4S C22H2 6N4 NiO8 f.w 35 0.81 38 1.84 31 3. 93 330 .04 533 .18 T/K 22 3( 2) 22 3( 2) 22 3( 2) 22 3( 2) 22 3( 2) λ/Å 0.710 73 Å 0.710 73 0.710 73 0.710 73 0.710 73 Crystal system Monoclinic Monoclinic Orthorhombic ... improving the structural insights in terms of hydrogen bonding tendencies of the amino acid components 3- 5 Experimental 3- 5-1 Synthesis of ligan...

Ngày tải lên: 15/09/2015, 17:10

35 214 0
Cu(II) and Ni(II) complexes of n (2 hydroxybenzyl) amino acid ligands  synthesis, structures, properties and catecholase activity 2

Cu(II) and Ni(II) complexes of n (2 hydroxybenzyl) amino acid ligands synthesis, structures, properties and catecholase activity 2

... noradrenaline and dopa.8 Oxidation of mono- and diphenol-containing neurotransmitters such as dopamine, epinephrine, norepinephrine and serotonin have been found associated with the Fe(II) and Cu(II) ... hydrogen bonds generate 3D hydrogen bonded network connectivity in IIA-4 Hydrogen bond distances and angles are shown in Table 2- 8 A portion of the hydrogen bonding connecti...

Ngày tải lên: 15/09/2015, 17:10

128 340 0
Cu(II) and Ni(II) complexes of n (2 hydroxybenzyl) amino acid ligands  synthesis, structures, properties and catecholase activity

Cu(II) and Ni(II) complexes of n (2 hydroxybenzyl) amino acid ligands synthesis, structures, properties and catecholase activity

... acid H2Saes N- (2- hydroxysalicylidene)-aminoethanesulfonic acid H2Sam N- (2- hydroxybenzyl)- aminomethanesulfonic acid H2Sae N- (2- hydroxybenzyl)- aminoethanesulfonic acid H2Sas N -(2- hydroxybenzyl)- L-aspartic ... salicylaldehyde and amino acids have focused upon the tridentate ligand binding mode of these ligands. 18-19 Transition metal complexes of...

Ngày tải lên: 15/09/2015, 17:10

82 583 0
Metal complexes of n (7 hydroxyl 4 methyl 8 coumarinyl)  amino acid, n (2 pyridylmethyl) amino acid and related ligands synthesis, structural, photophysical and gelation properties

Metal complexes of n (7 hydroxyl 4 methyl 8 coumarinyl) amino acid, n (2 pyridylmethyl) amino acid and related ligands synthesis, structural, photophysical and gelation properties

... N- (7- hydroxy -4- methyl- 8- coumarinyl)- L-serine N- 2( -pyridylmethyl)- aminoethanesulfonic acid N- (2- pyridylmethylene)-aminoethanesulfonic acid N- 2( -pyridylmethyl)- L-alanine N- 2( -pyridylmethyl)- b -alanine N- (2- pyridylmethylene)-b-alanine ... N- (2- pyridylmethylene)-b-alanine N- (2- pyridylmethyl)- L-glutamic acid N- (2- pyridylmethyl)- glyc...

Ngày tải lên: 14/09/2015, 08:47

276 485 0
Báo cáo Y học: Identification and characterization of a new gene from Variovorax paradoxus Iso1 encoding N -acyl-D-amino acid amidohydrolase responsible for D-amino acid production pdf

Báo cáo Y học: Identification and characterization of a new gene from Variovorax paradoxus Iso1 encoding N -acyl-D-amino acid amidohydrolase responsible for D-amino acid production pdf

... towards N- acetyl-D-methionine, N- acetyl-D-alanine, N- acetyl-D-leucine and N- chloroacetyl-D-phenylalanine than towards N- acetyl-D-valine, N- acetyl-D-phenylalanine, N- acetyl-D-tryptophan, N- acetyl-D-tyrosine ... A- 6-D50061: Alcaligenes xylosoxydans ssp xylosoxydans A- 6 N- acylD-glutamate amidohydrolase; Alicaligenes faecalis-DA1: Alcaligenes faecalis DA1 N- acyl D-amino...

Ngày tải lên: 08/03/2014, 16:20

11 657 0
Tài liệu Báo cáo khoa học: N-Methyl-L-amino acid dehydrogenase from Pseudomonas putida A novel member of an unusual NAD(P)-dependent oxidoreductase superfamily ppt

Tài liệu Báo cáo khoa học: N-Methyl-L-amino acid dehydrogenase from Pseudomonas putida A novel member of an unusual NAD(P)-dependent oxidoreductase superfamily ppt

... N-Methyl-L-amino acid dehydrogenase from P putida H Mihara et al ammonia are formed from methylamine and glutamate by N-methylglutamate synthase (EC 2.1.1.21) [16] Another A aminovorans strain, ... were of analytical grade from Nacalai Tesque (Kyoto, Japan) and Wako Pure Chemical Industries (Osaka, Japan) Culture and screening of bacteria Bacterial strains were cultivated...

Ngày tải lên: 19/02/2014, 16:20

7 518 0
Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf

Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf

... et al Staphylococcal nuclease refolding investigated Two point-mutated proteins, with a single base substitution of alanine for tryptophan (W14 0A) and alanine for lysine (K13 3A) , and two truncated ... both the wild-type protein and mutants E142O and K13 3A Thermal analysis of protein unfolding The DSC curves of the wild-type protein and the mutants K13 3A,...

Ngày tải lên: 20/02/2014, 01:20

7 552 0
Báo cáo khoa học: Substrate specificity and transport mode of the proton-dependent amino acid transporter mPAT2 potx

Báo cáo khoa học: Substrate specificity and transport mode of the proton-dependent amino acid transporter mPAT2 potx

... transporter to the internal membrane side is the rate-limiting step and not – as proposed for most of the other electrogenic symporters – the return of the unloaded transporter to the outside of the membrane ... interpreted as the first evidence for a restricted velocity in the translocation step of the loaded transporter by the sterical conformation of...

Ngày tải lên: 07/03/2014, 16:20

8 542 0
Báo cáo khoa học: Substrate specificity of the human UDP-glucuronosyltransferase UGT2B4 and UGT2B7 Identification of a critical aromatic amino acid residue at position 33 doc

Báo cáo khoa học: Substrate specificity of the human UDP-glucuronosyltransferase UGT2B4 and UGT2B7 Identification of a critical aromatic amino acid residue at position 33 doc

... CTGGTGTGGCCCACAGAACTCAGCCACTGGATGAATATAAAG CTTTATATTCATCCAGTGGCTGAGTTCTGTGGGCCACACCAG CTGGTGTGGCCCACAGAATACAGCCACTGGATGAATATAAAG CTTTATATTCATCCAGTGGCTGTATTCTGTGGGCCACACCAG CTGGTGTGGGCAGCAGAACTCAGCCATTGGATGAATATAAAG CTTTATATTCATCCAATGGCTGAGTTCTGCTGCCCACACCAG ... CTTTATATTCATCCAATGGCTGAGTTCTGCTGCCCACACCAG CTGGTGTGGGCAGCAGAATACAGCCATTGGATGAATATAAAG CTTTATATTCATCCAATGGCTGTATTCTGCTGCCCACACCAG 2B4F...

Ngày tải lên: 23/03/2014, 09:21

9 343 0
Báo cáo khoa học: Cloning and functional characterization of Arabidopsis thaliana D-amino acid aminotransferase – D-aspartate behavior during germination pdf

Báo cáo khoa học: Cloning and functional characterization of Arabidopsis thaliana D-amino acid aminotransferase – D-aspartate behavior during germination pdf

... appearance of other d-amino acids This is the first report, for eukaryotes, of cDNA cloning and functional characterization of d-AAT acid aminotransferase in A thaliana tion rate of main roots and hypocotyls ... between d-amino acids, was cloned and characterized This represents the first cDNA cloning and functional characterization of a d-AAT of eukary...

Ngày tải lên: 30/03/2014, 04:20

13 401 0
DESIGN, SYNTHESIS AND STUDY OF DNA-TARGETED BENZIMIDAZOLE-AMINO ACID CONJUGATES

DESIGN, SYNTHESIS AND STUDY OF DNA-TARGETED BENZIMIDAZOLE-AMINO ACID CONJUGATES

... Research Integrity and Copyright Disclaimer Title of Thesis/Dissertation: Design, Synthesis and Study of DNA-Targeted Benzimidazole-Amino Acid Conjugates For the degree of Master of Science Choose ... http://www.purdue.edu/policies/pages/teach_res_outreach/c_22.html DESIGN, SYNTHESIS AND STUDY OF DNA-TARGETED BENZIMIDAZOLE-AMINO ACID CONJUGATES A Th...

Ngày tải lên: 24/08/2014, 11:27

144 301 1
Solid-Phase Synthesis of N-Carboxyalkyl Unnatural Amino Acids

Solid-Phase Synthesis of N-Carboxyalkyl Unnatural Amino Acids

... Evaluation of Alkyl Halides in the Synthesis of Unnatural Amino Acids .43 3.3 Combinatorial Synthesis of N-Carboxyalkyl Amino Acid Analogs 44 3.4 Deprotection of Benzyl-Protected N-Carboxyalkyl Amino ... 2010, Solid-Phase Synthesis of N-Carboxyalkyl Unnatural Amino Acids Major Professor: Martin J 9^/NMMEKl, Ph.D A novel route has been developed for the...

Ngày tải lên: 24/08/2014, 13:46

257 322 0
Báo cáo Y học: Role of tyrosine 238 in the active site of Rhodotorula gracilis D-amino acid oxidase A site-directed mutagenesis study docx

Báo cáo Y học: Role of tyrosine 238 in the active site of Rhodotorula gracilis D-amino acid oxidase A site-directed mutagenesis study docx

... D-phenylalanine and D-tryptophan Like the wild-type DAAO, basic D-amino acids are poor substrates for Y2 38 mutants (data not shown) The mutants maintain the stereospecicity of the wild-type RgDAAO; ... size of the ligand side chain [27] Our results indicate that the role of Y2 23 and Y2 38 in the active site of RgDAAO is different from that of the tyro...

Ngày tải lên: 17/03/2014, 17:20

10 496 0
Tài liệu Báo cáo khoa học: The antibacterial and antifungal properties of trappin-2 (pre-elafin) do not depend on its protease inhibitory function pptx

Tài liệu Báo cáo khoa học: The antibacterial and antifungal properties of trappin-2 (pre-elafin) do not depend on its protease inhibitory function pptx

... suppress its protease inhibitory properties, we show that the antibacterial ⁄ fungicidal action of trappin-2 is independent of its antiprotease function Although we have not determined its exact ... that trappin-2, and to a lesser extent elafin, have broad antibacterial and antifungal properties that are independent of their antiprotease function and p...

Ngày tải lên: 18/02/2014, 17:20

13 610 0
w