Structural and epitope characterization of dust mites allergens, der f 13 and blo t 5

Structural and epitope characterization of dust mites allergens, der f 13 and blo t 5

Structural and epitope characterization of dust mites allergens, der f 13 and blo t 5

... STRUCTURAL AND EPITOPE CHARACTERIZATION OF DUST MITES ALLERGENS, DER F 13 AND BLO T CHAN SIEW LEONG (B Sc., USM) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF BIOLOGICAL ... 3.1 Expression and purification of His-tag Der f 13 79 Figure 3.2 Expression and purification of GST-tag Der f 13 79 Figure 3.3 Gel filtratio...

Ngày tải lên: 14/09/2015, 18:50

197 258 0
Structural and epitope characterization of major allergens from dust mite, BLO t 21 and DER f 7

Structural and epitope characterization of major allergens from dust mite, BLO t 21 and DER f 7

... Superimposition of the NMR structure of Blo t 21 with Blo t and Der p 58 Figure 3 .7 The allergenicity of Blo t 21, Der f 21, Der p and Blo t 60 Figure 3.8 The CD spectrum of Blo t 21, Der f 21, Blo t and ... cells 25 Blot21_E74A_up Blot21_E74A_down Blot21_K76A_down Blot21_K76A_down Blot21_D79A_up Blot21_D79A_down Blot21_E84A_up Blot21_...

Ngày tải lên: 09/09/2015, 18:55

159 323 0
Identification and characterization of novel group 5 and group 21 allergens from dust mite and ige binding epitope mapping of blo t 5

Identification and characterization of novel group 5 and group 21 allergens from dust mite and ige binding epitope mapping of blo t 5

... thermal treatment on IgE- binding activities of Blo t 92 and Blo t 21 4.2.2 Effect of thermal treatment on Blo t and Blo t 21 folding 94 4.2.3 Resistance of IgE- binding of Blo t and Blo t 21 to acid, ... 21 75 and Blo t 3.2.10 Quantitative end point cross-inhibition of Blo t 21 and 77 Blo t 3.2.11 Localization of Blo...

Ngày tải lên: 14/09/2015, 12:44

259 432 0
Báo cáo hóa học: " Epitope characterization of the protective monoclonal antibody VN04-2 shows broadly neutralizing activity against highly pathogenic H5N1" ppt

Báo cáo hóa học: " Epitope characterization of the protective monoclonal antibody VN04-2 shows broadly neutralizing activity against highly pathogenic H5N1" ppt

... antibody binding and the utility of the antibody for protection against recently circulating H5N1 viruses The mAb VN04-2 was raised against the HA of A/Vietnam/ 1203/04, therefore to select the ... lack of antibody binding [12] Here we evaluated binding of VN04-2 to a variety of H5 hemagglutinins (HA) independent of the HI assay, to determine the actual...

Ngày tải lên: 20/06/2014, 01:20

4 344 0
the behavior of stock market prices eugene f fama the journal phần 5 pdf

the behavior of stock market prices eugene f fama the journal phần 5 pdf

... diversification has the effect of reducing the dispersion of the distribution of the return on the portfolio, even though the variance of that distribution may be infinite Finally, although the ... rankings of the year-by-year returns of each fund The most impressive feature of Table 18 is the inconsistency in the rankings of year-by-year returns for any...

Ngày tải lên: 09/08/2014, 20:20

14 300 0
Expressed sequence tags analysis of major allergens producing dust mites and molecular characterization of their allergens

Expressed sequence tags analysis of major allergens producing dust mites and molecular characterization of their allergens

... www.pdffactory.com List of Tables IgE binding rates of the cloned dust mite allergens and their biological properties 22 Overview of the productions of recombinant mite allergens: from the aspects of the production ... mutants of the mites FABP homologues 70 Overview of the characteristics and statistical data of the dust mites EST collections 80 Summary and...

Ngày tải lên: 12/09/2015, 11:08

312 4K 0
Group 2 allergens from dust mite  epitope mapping and functional characterization of der p 2, and identification of a paralogue of der f 2

Group 2 allergens from dust mite epitope mapping and functional characterization of der p 2, and identification of a paralogue of der f 2

... allergen from Dermatophagoides farinae: a paralogue of Der f 2? 75 4.1 Introduction 75 4 .2 Identification, isolation and characterization of Der f 22 76 4.3 Genomic organization of Der f 22 and Der f ... antibodies raised against Der f 22 and Der f 2, and immunolocalization on D farinae sections 93 Figure 4. 12 Concentration of Der...

Ngày tải lên: 15/09/2015, 17:09

235 904 0
Tài liệu Báo cáo khoa học: Purification and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx

Tài liệu Báo cáo khoa học: Purification and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx

... Kumagaye KY, Nakajima K, Watanabe T, Kawai T, Kawakami Y, Niidome T, Sawada K, Nishizawa Y et al (1994) Omega-agatoxinTK containing D-serine at position 46, but not synthetic omega-[L-Ser46]agatoxin-TK, ... Inoue A, Kawakami Y, Nishizawa Y, Katayama K & Kuwada M (1995) Isolation and characterization of a peptide isomerase from funnel web spider venom J Biol Chem 270, 16719–16723 To...

Ngày tải lên: 18/02/2014, 17:20

12 617 0
Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx

Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx

... 5¢-CTTTATTTTCAGGGCGCCATGAAGCGCG CAAGACCGTCTGAA-3¢ and a reverse oligomer 5¢-AGCT CGAATTCG GATCCGGTACCTCAGAAGGTAGACAG CAGAACC-3¢ For derivitization with TMR, a Gly-Gly-Cys sequence was introduced at the ... chain and hides a large amount of the hydrophobic surface area Surface area calculations for the pentamer give a total surface ˚ ˚ area of $ 81 000 A2 with 30% ($ 24 000 A...

Ngày tải lên: 19/02/2014, 06:20

10 648 0
Tài liệu Báo cáo Y học: Structural and biochemical characterization of neuronal calretinin domain I– II (residues 1– 100) Comparison to homologous calbindin D28k domain I–II (residues 1 –93) pdf

Tài liệu Báo cáo Y học: Structural and biochemical characterization of neuronal calretinin domain I– II (residues 1– 100) Comparison to homologous calbindin D28k domain I–II (residues 1 –93) pdf

... expressed and purified the homologous domain of CR (CR I II, residues 1 1 00) [23,32] This has allowed us to analyze the biochemical and structural properties of CR I– II and to compare them with Calb I II ... I II compared to Calb I II In contrast to Calb I II, CR I II shows no tendency to dimerize and both EF-hands of CR I II bind calcium We conclud...

Ngày tải lên: 22/02/2014, 07:20

9 648 0
Báo cáo khoa học: Biochemical characterization of USP7 reveals post-translational modification sites and structural requirements for substrate processing and subcellular localization pptx

Báo cáo khoa học: Biochemical characterization of USP7 reveals post-translational modification sites and structural requirements for substrate processing and subcellular localization pptx

... 1102 USP7- FL USP7 1-560 USP7 208-560 USP7 208-1102 EGFP USP7 1-205-EGFP EGFP USP7 20-205-EGFP EGFP USP7 50-205-EGFP EGFP USP7 70-205-EGFP Fig Structural functional features and constructs of USP7 ... Fernandez-Montalvan et al Biochemical characterization of USP7 Fig Enzymatic characterization of USP7 (A) Progress curves for the USP7- catalyzed hydrolysi...

Ngày tải lên: 07/03/2014, 05:20

15 593 0
Báo cáo khoa học: Characterization of structural and catalytic differences in rat intestinal alkaline phosphatase isozymes pdf

Báo cáo khoa học: Characterization of structural and catalytic differences in rat intestinal alkaline phosphatase isozymes pdf

... Divergences of rat alkaline phosphatase isozymes T Harada et al A B Fig Stereoviews of the residues near metal-binding site in (A) rat intestinal alkaline phosphatase- I (rIAP-I) and (B) rIAP-II ... Residues indirectly associating with the metal via water molecules Fig Immunological detection of rat intestinal alkaline phosphatase (rIAP) isozymes in rat...

Ngày tải lên: 07/03/2014, 17:20

10 530 0
Báo cáo Y học: Structural and biochemical characterization of calhepatin, an S100-like calcium-binding protein from the liver of lungfish (Lepidosiren paradoxa) docx

Báo cáo Y học: Structural and biochemical characterization of calhepatin, an S100-like calcium-binding protein from the liver of lungfish (Lepidosiren paradoxa) docx

... analysis The 105 000 g supernatant of lungfish liver (lane 1), skeletal muscle (lane 2), intestine (lane 3), lung (lane 4), brain (lane 5), adipose tissue (lane 6), heart (lane 7) and skin (lane ... showed that the protein is in a monomer–dimer equilibrium and that the dissociation constant is in the micromolar range for the apoprotein and in the submicromolar range f...

Ngày tải lên: 08/03/2014, 22:20

9 445 0
Báo cáo khoa học: Functional and structural characterization of novel mutations and genotype–phenotype correlation in 51 phenylalanine hydroxylase deficient families from Southern Italy docx

Báo cáo khoa học: Functional and structural characterization of novel mutations and genotype–phenotype correlation in 51 phenylalanine hydroxylase deficient families from Southern Italy docx

... analysis of the PAH gene in 51 unrelated HPA patients from Southern Italy In addition to the molecular epidemiology of PAH mutations, we characterized the functional properties of two novel mutations ... phenylalanine hydroxylase deciency in Southern Italy: a 96% detection rate with ten novel mutations Ann Hum Genet 71, 1 8519 3 10 Waters PJ (2003) How PA...

Ngày tải lên: 16/03/2014, 01:20

12 491 0
Báo cáo khoa học: Structural and functional characterization of human Iba proteins ppt

Báo cáo khoa học: Structural and functional characterization of human Iba proteins ppt

... cross-linking efciency of Iba1 and Iba2 or in the overall morphology of the generated lament bundles Calcium afnity of Iba1 and Iba2 Homodimerization and actin binding of Iba1 and Iba2 were similar ... presented here reveals functional similarities and differences between Iba1 and Iba2 We investigated Ca2+ binding and homodimerization of Iba1 and Iba2 Fur...

Ngày tải lên: 16/03/2014, 06:20

14 546 0
Từ khóa:
w