Molecular characterization and developmental analysis of the TGF beta 3 gene in zebrafish
... mutants, trunk notochords are present. This shows that spt mutation can suppress the 35 Molecular characterization and developmental analysis of the TGF Beta 3 gene in zebrafish flh mutation, suggesting that in the midline, flh is involved in promoting ... Molecular characterization and developmental analysis of the TGF Beta 3 gene in zebrafish phosphorylating TβR...
Ngày tải lên: 14/09/2015, 18:03
... GTCCACATCAACGGCCGCCGGCTCG AGCCAACAGACACTCCTGTGTTCC CATGCCAGACCCTGATATTATCACC ACCTACACCAATGTCACCTGGAC GTGCCACACCTACTATGACCACAG TCAAGCCTCCAAACCAAGCC TGGCGGTCCATAAATGAGGTG TATGCAGCTTTGGCAATTCCC TTGATCTTTAGCAACTGTATCTG ... TGGTGGAGGCCTGTTCAGAGC CCAAGTTGTGGGCTGTCAACAC CAGAGTCCTCCTGGTGGACATTC ATTACCAAGCGCAACGCTAGGC CATGTGGCCAACATGTGTG TGATTTGGTCAAGGTAGCC CCTTCTACAACACCAAATGATTGCC AGGCCAGGATGTCAACAC...
Ngày tải lên: 12/08/2014, 04:21
... mouse, Fugu, and zebrafish 63 -64 3.5 Assembled sequences of irf6 genomic fragments 64 -66 3 .6 The irf6 gene locus on the LG22 in T51 RH panel and in the Ensembl zebrafish version (ZV6) 68 -69 3.7 Whole-mount ... morpholinos 85 3.14 Loss of irf6 function phenotypes 86- 87 3.15 Comparison of expression of molecular markers in irf6 morphants and wildtype 91-92 3...
Ngày tải lên: 14/09/2015, 12:44
Báo cáo khoa học: Characterization and expression analysis of the aspartic protease gene family of Cynara cardunculus L. docx
... pattern of expression of a gene [34–39] To evaluate the relevance of the leader intron in cardosin expression, we deleted it from the 5¢-flanking region of the genes (Fig 8) The deletion of the cardosin ... region of the cardosin B gene (from ) 147 bp to + 238 bp) .The 529 bp of the promoter region of the cardosin A gene that is relevant for gene...
Ngày tải lên: 30/03/2014, 09:20
Báo cáo y học: " Complete coding sequence characterization and comparative analysis of the putati" docx
... drafted the manuscript SP and KS participated in the sequence alignment PL and YP participated in the design of the study and performed the data statistical analysis YP conceived of the study in ... only 64% sequence identity with the other HRV-Cs HRV-CU072 coding sequence analysis To investigate the molecular characteristics of the putative new HRV-C...
Ngày tải lên: 11/08/2014, 21:21
Báo cáo y học: " Assessment and histological analysis of the IPRL technique for sequential in situ liver biopsy" ppsx
... Scott Lindsay from Veterinary Pathology Diagnostic Services, Faculty of Veterinary Science, University of Sydney, for assistance in interpretation of histology results The authors acknowledge the ... Page of extending between portal triads The sparsity of these septal branches in the rat makes the concept of the acinus unlikely in this species Although the va...
Ngày tải lên: 13/08/2014, 13:20
Molecular characterization and developmental expression patterns of the zebrafish twist gene family
... pattern with other species 83 4.5.1 Zebrafish twist1 a and twist1 b genes 83 4.5.2 Zebrafish twist2 85 4.5.3 Zebrafish twist3 86 4.6 Shared and unique expression sites of the zebrafish twist genes 86 ... proteins generated by the neighbor-joining method Figure 3.6: Gene structure of twist1 a, twist1 b, twist2 and twist3 Figure 3.7: RT-PCR of zebrafish...
Ngày tải lên: 16/10/2015, 15:38
Tài liệu Báo cáo khoa học: Cloning, characterization and expression analysis of interleukin-10 from the common carp, Cyprinus carpio L. docx
... to their positions The arrowheads depict the residues important for the structural core of the IL-10 gene The underlined amino acid residues are the signal sequences of the respective genes The ... conclusion, the IL-10 gene from carp has been isolated and its genomic structure and expression analysis investigated This work will pave the way for further inves...
Ngày tải lên: 20/02/2014, 02:21
Tài liệu Báo cáo Y học: Purification, characterization, immunolocalization and structural analysis of the abundant cytoplasmic b-amylase from Calystegia sepium (hedge bindweed) rhizomes ppt
... b-amylase (Cys83, Cys96, Cys209 and Cys344) are homologous to those found in soybean b-amylase (Cys82, Cys97, Cys208 and Cys343) On the analogy of the soybean b-amylase, the active site of the ... for the b-amylase from C sepium using the X-ray coordinates of the soybean b-amylase (Fig 4) According to the Ramachandran plot of this model the f and c...
Ngày tải lên: 22/02/2014, 07:20
Báo cáo khoa học: Isolation, characterization and expression analysis of a hypoxia-responsive glucose transporter gene from the grass carp, Ctenopharyngodon idellus potx
... 5¢-CCTGATCGACGCACGAGT-3¢ and GT1-R, 5¢-TTTTGCAAGTCATAGTAATCAGTTT-3¢ for GTcDNA1 (2150 bp); and GT2-F, 5¢-CACCAGCAACTAC CTGATCGA-3¢ and GT2-R, 5¢-CACAAAATATGCTT CCAAGTGC-3¢ for GT-cDNA2 (3043 bp) RNA isolation and ... revealed two putative polyadenylation (ATTAAA) signals: one is located 18 bp upstream from the poly (A) of GT-cDNA1 and another is located 11 bp upstream from...
Ngày tải lên: 17/03/2014, 03:20
báo cáo khoa học: " Characterization and structural analysis of wild type and a non-abscission mutant at the development funiculus (Def) locus in Pisum sativum L" pdf
... and attachment of pea seeds to the replum in a pod of the def mutant pea The def mutant pea shows a swollen and thick funicle compared to the wild type Arrows indicate the AZ and ALZ in the wild ... growing of the plants, harvested materials, carried out the structural examination and drafted the manuscript YKL participated in designing t...
Ngày tải lên: 12/08/2014, 03:20
Comparing the cultural and linguistic analysis of the English word “meal” and words relating to it in contrast with Vietnamese equivalents.
... of word meal in English and words relating to it (in contrast with Vietnamese equivalents) - Definition of word meal - Field of word meal in English and in Vietnamese equivalents - Cultural and ... with the notion of meal are called field of word meal In our opinion, field of word meal is all the words relating to it mai...
Ngày tải lên: 15/04/2013, 15:11
Tài liệu Static and Dynamic Analysis of the Internet’s Susceptibility to Faults and Attacks docx
... 0.1 (10% attacks) We analyze both static and dynamic susceptibility of the Internet to faults and attacks In static analysis, we first reconfirm previous work of Albert et al [5] Based on these results, ... of the Internet’s susceptibility to attacks and faults, and discovered two interesting results; First, the Internet is much more preferential tha...
Ngày tải lên: 18/02/2014, 01:20
Tài liệu Báo cáo khoa học: Molecular characterization and allergenic activity of Lyc e 2 (b-fructofuranosidase), a glycosylated allergen of tomato pdf
... The histamine releases were measured by an enzyme immunoassay (Immunotech) After subtraction of the spontaneous release of the basophils, the allergeninduced histamine release was calculated as ... self-prepared tomato extract, nLyc e 2, rLyc e 2, horseradish peroxidase, deglycosylated horseradish peroxidase, the glycopeptide MUXF and MUXF conjugated to BSA as well as BSA alone...
Ngày tải lên: 21/02/2014, 00:20
Báo cáo khoa học: Purification and structural analysis of the novel glycoprotein allergen Cyn d 24, a pathogenesis-related protein PR-1, from Bermuda grass pollen pot
... we have purified, cloned and characterized Cyn d 24 as a novel pathogenesis-related protein from BGP Additionally, the identification of Cyn d 24 has identified the involvement of a novel class of ... AGAD AADA.NA.VG D. D 113 Zea AYA.S A- QRQG LI GG FW AGAD.SASDA.GS.VS QY.DHDT.S 112 Nicotiana AYA.N S-Q.AA NL HGQ AE -GDFMTAAKA.EM.V QY.DHD 118 Cyn d 24 DQGKM...
Ngày tải lên: 07/03/2014, 12:20